Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625190_at:

>probe:Drosophila_2:1625190_at:406:449; Interrogation_Position=1056; Antisense; GATCCGGAGTATCATTGCCTTGTGC
>probe:Drosophila_2:1625190_at:527:253; Interrogation_Position=1096; Antisense; CAAATGCCCCTTCAACTGGTGGAAA
>probe:Drosophila_2:1625190_at:185:239; Interrogation_Position=1120; Antisense; AATCTCGATGGCGTTGTCTACTGCA
>probe:Drosophila_2:1625190_at:257:397; Interrogation_Position=1151; Antisense; GACACGTTTCCTGTCTCAATCAGTA
>probe:Drosophila_2:1625190_at:74:437; Interrogation_Position=1240; Antisense; GAGGAGGCTCTTTATTGCCCACAAT
>probe:Drosophila_2:1625190_at:450:291; Interrogation_Position=1279; Antisense; CGGGATGTCCAGTACGAGGTTTCAA
>probe:Drosophila_2:1625190_at:446:435; Interrogation_Position=1294; Antisense; GAGGTTTCAATGAGTGCCCTGCCAA
>probe:Drosophila_2:1625190_at:439:237; Interrogation_Position=1317; Antisense; AATCGATAACTACCTGGCCACGCTG
>probe:Drosophila_2:1625190_at:642:103; Interrogation_Position=1377; Antisense; AGACATCTCCGTTCTCAGGGTTTAC
>probe:Drosophila_2:1625190_at:329:49; Interrogation_Position=1415; Antisense; ATGCCCAATACTATATCCGACTGCT
>probe:Drosophila_2:1625190_at:713:631; Interrogation_Position=1430; Antisense; TCCGACTGCTGAATAACACCTGGTT
>probe:Drosophila_2:1625190_at:387:661; Interrogation_Position=1476; Antisense; TAACATCATGTCCATTTTCGTCGGC
>probe:Drosophila_2:1625190_at:192:65; Interrogation_Position=1507; Antisense; ATGGTGGCCATATTCGAGATACTCT
>probe:Drosophila_2:1625190_at:294:427; Interrogation_Position=1522; Antisense; GAGATACTCTTTTTTGTCACCAAGT

Paste this into a BLAST search page for me
GATCCGGAGTATCATTGCCTTGTGCCAAATGCCCCTTCAACTGGTGGAAAAATCTCGATGGCGTTGTCTACTGCAGACACGTTTCCTGTCTCAATCAGTAGAGGAGGCTCTTTATTGCCCACAATCGGGATGTCCAGTACGAGGTTTCAAGAGGTTTCAATGAGTGCCCTGCCAAAATCGATAACTACCTGGCCACGCTGAGACATCTCCGTTCTCAGGGTTTACATGCCCAATACTATATCCGACTGCTTCCGACTGCTGAATAACACCTGGTTTAACATCATGTCCATTTTCGTCGGCATGGTGGCCATATTCGAGATACTCTGAGATACTCTTTTTTGTCACCAAGT

Full Affymetrix probeset data:

Annotations for 1625190_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime