Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625191_at:

>probe:Drosophila_2:1625191_at:48:533; Interrogation_Position=1501; Antisense; GGTGGCTATGCCTATCGGGACTCCG
>probe:Drosophila_2:1625191_at:444:635; Interrogation_Position=1526; Antisense; TCGAGCATTCTTCCACTGAGAGCGG
>probe:Drosophila_2:1625191_at:144:425; Interrogation_Position=1543; Antisense; GAGAGCGGCCTGACCGTAAATGGTT
>probe:Drosophila_2:1625191_at:692:489; Interrogation_Position=1626; Antisense; GTACTACGGACAATCGGATGGCGCC
>probe:Drosophila_2:1625191_at:487:289; Interrogation_Position=1688; Antisense; CGGATCCATCCACGCGAAAGGTTAA
>probe:Drosophila_2:1625191_at:315:471; Interrogation_Position=1747; Antisense; GTTCCGTCCGTGATTTTTGTTGCTT
>probe:Drosophila_2:1625191_at:400:603; Interrogation_Position=1764; Antisense; TGTTGCTTTCGCGATGGCCGGAACG
>probe:Drosophila_2:1625191_at:288:197; Interrogation_Position=1785; Antisense; AACGGCTGTGTTCATCATGGAATCC
>probe:Drosophila_2:1625191_at:236:235; Interrogation_Position=1805; Antisense; AATCCGAATCGGAGGCCTTCGAGCA
>probe:Drosophila_2:1625191_at:454:193; Interrogation_Position=1837; Antisense; AACTCACCCGAAATGCTTTGTCTGC
>probe:Drosophila_2:1625191_at:627:341; Interrogation_Position=1851; Antisense; GCTTTGTCTGCGCTATCAGTACTAT
>probe:Drosophila_2:1625191_at:277:67; Interrogation_Position=1939; Antisense; ATGGAAGATCCACCTAACTAACTAT
>probe:Drosophila_2:1625191_at:82:659; Interrogation_Position=1957; Antisense; TAACTATGGTCCCAGTTACTCCAGC
>probe:Drosophila_2:1625191_at:331:669; Interrogation_Position=1973; Antisense; TACTCCAGCTGCATCGGGTATTTTA

Paste this into a BLAST search page for me
GGTGGCTATGCCTATCGGGACTCCGTCGAGCATTCTTCCACTGAGAGCGGGAGAGCGGCCTGACCGTAAATGGTTGTACTACGGACAATCGGATGGCGCCCGGATCCATCCACGCGAAAGGTTAAGTTCCGTCCGTGATTTTTGTTGCTTTGTTGCTTTCGCGATGGCCGGAACGAACGGCTGTGTTCATCATGGAATCCAATCCGAATCGGAGGCCTTCGAGCAAACTCACCCGAAATGCTTTGTCTGCGCTTTGTCTGCGCTATCAGTACTATATGGAAGATCCACCTAACTAACTATTAACTATGGTCCCAGTTACTCCAGCTACTCCAGCTGCATCGGGTATTTTA

Full Affymetrix probeset data:

Annotations for 1625191_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime