Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625192_at:

>probe:Drosophila_2:1625192_at:27:177; Interrogation_Position=2427; Antisense; AAACCCACATCGATACTCTCGACGA
>probe:Drosophila_2:1625192_at:140:409; Interrogation_Position=2447; Antisense; GACGACAGACAAACAAGCGGCGCCT
>probe:Drosophila_2:1625192_at:274:121; Interrogation_Position=2462; Antisense; AGCGGCGCCTAATGATGCGCAGCAG
>probe:Drosophila_2:1625192_at:663:205; Interrogation_Position=2505; Antisense; AAGCGCGTTAATTTCGTTGACAGCA
>probe:Drosophila_2:1625192_at:219:59; Interrogation_Position=2539; Antisense; ATGATAGCTCAAGCGCGAAACCGAC
>probe:Drosophila_2:1625192_at:472:433; Interrogation_Position=2633; Antisense; GAGTGATTTCGATTTTTCAACCGGC
>probe:Drosophila_2:1625192_at:547:699; Interrogation_Position=2645; Antisense; TTTTTCAACCGGCAGCGAGGCAAAG
>probe:Drosophila_2:1625192_at:703:17; Interrogation_Position=2691; Antisense; ATTTCGAGCTCTAATTTGTTGCCAT
>probe:Drosophila_2:1625192_at:638:317; Interrogation_Position=2742; Antisense; GCCGAGCCACCCAATTCAATGTGAA
>probe:Drosophila_2:1625192_at:579:709; Interrogation_Position=2756; Antisense; TTCAATGTGAACGACCGTCTCGATT
>probe:Drosophila_2:1625192_at:329:413; Interrogation_Position=2768; Antisense; GACCGTCTCGATTTATTGCCAATTC
>probe:Drosophila_2:1625192_at:156:185; Interrogation_Position=2897; Antisense; AAAATGGCGAACCTCAAGCCGCACA
>probe:Drosophila_2:1625192_at:229:479; Interrogation_Position=2927; Antisense; GTTTCTGCTTACTTAGGCGACGACA
>probe:Drosophila_2:1625192_at:685:337; Interrogation_Position=2953; Antisense; GCTAACAATGCTCGTTCAATTCAAT

Paste this into a BLAST search page for me
AAACCCACATCGATACTCTCGACGAGACGACAGACAAACAAGCGGCGCCTAGCGGCGCCTAATGATGCGCAGCAGAAGCGCGTTAATTTCGTTGACAGCAATGATAGCTCAAGCGCGAAACCGACGAGTGATTTCGATTTTTCAACCGGCTTTTTCAACCGGCAGCGAGGCAAAGATTTCGAGCTCTAATTTGTTGCCATGCCGAGCCACCCAATTCAATGTGAATTCAATGTGAACGACCGTCTCGATTGACCGTCTCGATTTATTGCCAATTCAAAATGGCGAACCTCAAGCCGCACAGTTTCTGCTTACTTAGGCGACGACAGCTAACAATGCTCGTTCAATTCAAT

Full Affymetrix probeset data:

Annotations for 1625192_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime