Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625194_at:

>probe:Drosophila_2:1625194_at:239:281; Interrogation_Position=268; Antisense; CTCAAACCCACGTCAGTCAATTTAA
>probe:Drosophila_2:1625194_at:518:215; Interrogation_Position=298; Antisense; AAGTTGAAGGTCTTCGCCTCGAACA
>probe:Drosophila_2:1625194_at:213:239; Interrogation_Position=331; Antisense; AATCTCACCTGTATTGTGGCCGGCT
>probe:Drosophila_2:1625194_at:446:555; Interrogation_Position=380; Antisense; GGACGCAGAATAATCGGCCCTTCAA
>probe:Drosophila_2:1625194_at:503:297; Interrogation_Position=396; Antisense; GCCCTTCAAACGTGGCTTGTTGTCA
>probe:Drosophila_2:1625194_at:551:343; Interrogation_Position=410; Antisense; GCTTGTTGTCAACCAGCCAGAGCAA
>probe:Drosophila_2:1625194_at:561:421; Interrogation_Position=429; Antisense; GAGCAATGGCAGAGTCATCTCCACT
>probe:Drosophila_2:1625194_at:411:609; Interrogation_Position=455; Antisense; TGACATTCTATCCACAGCCGGAGGA
>probe:Drosophila_2:1625194_at:548:437; Interrogation_Position=475; Antisense; GAGGACGACGGCACCATGCTTAAGT
>probe:Drosophila_2:1625194_at:209:445; Interrogation_Position=552; Antisense; GATGAATGTCATCTATCCGCCGCAG
>probe:Drosophila_2:1625194_at:77:719; Interrogation_Position=640; Antisense; TTCGAGTGCCACATCAAGTCCAATC
>probe:Drosophila_2:1625194_at:149:75; Interrogation_Position=668; Antisense; AGGAGCATCGCATCATGTGGTCGCA
>probe:Drosophila_2:1625194_at:435:201; Interrogation_Position=701; Antisense; AACCGGTCACCCAGAATGTATCTTG
>probe:Drosophila_2:1625194_at:25:235; Interrogation_Position=827; Antisense; AATCGGCTCCGGTCAACTTGAGGAT

Paste this into a BLAST search page for me
CTCAAACCCACGTCAGTCAATTTAAAAGTTGAAGGTCTTCGCCTCGAACAAATCTCACCTGTATTGTGGCCGGCTGGACGCAGAATAATCGGCCCTTCAAGCCCTTCAAACGTGGCTTGTTGTCAGCTTGTTGTCAACCAGCCAGAGCAAGAGCAATGGCAGAGTCATCTCCACTTGACATTCTATCCACAGCCGGAGGAGAGGACGACGGCACCATGCTTAAGTGATGAATGTCATCTATCCGCCGCAGTTCGAGTGCCACATCAAGTCCAATCAGGAGCATCGCATCATGTGGTCGCAAACCGGTCACCCAGAATGTATCTTGAATCGGCTCCGGTCAACTTGAGGAT

Full Affymetrix probeset data:

Annotations for 1625194_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime