Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625197_at:

>probe:Drosophila_2:1625197_at:624:131; Interrogation_Position=1656; Antisense; AACTAAACGTTTGCAGTCCAGTCTG
>probe:Drosophila_2:1625197_at:522:505; Interrogation_Position=1671; Antisense; GTCCAGTCTGATATCATTCACGAAT
>probe:Drosophila_2:1625197_at:472:279; Interrogation_Position=1696; Antisense; CTACACTTAGTTCCCGTTTGCAATA
>probe:Drosophila_2:1625197_at:553:361; Interrogation_Position=1715; Antisense; GCAATATACCGGCAAACCCATACTA
>probe:Drosophila_2:1625197_at:311:561; Interrogation_Position=1764; Antisense; GGAAACAGCAGCACGCTCCAAATTA
>probe:Drosophila_2:1625197_at:414:101; Interrogation_Position=1791; Antisense; AGAGAACATCTGACCGCCAATAACG
>probe:Drosophila_2:1625197_at:258:609; Interrogation_Position=1801; Antisense; TGACCGCCAATAACGTCGACTACTA
>probe:Drosophila_2:1625197_at:434:635; Interrogation_Position=1816; Antisense; TCGACTACTACGACCTGCAGTGAGG
>probe:Drosophila_2:1625197_at:513:587; Interrogation_Position=1845; Antisense; TGGAGTTCCGCGGAGTTGATGCAAC
>probe:Drosophila_2:1625197_at:583:265; Interrogation_Position=1895; Antisense; CAGAGATGCTTTGTGTGAATTCGGG
>probe:Drosophila_2:1625197_at:540:441; Interrogation_Position=1920; Antisense; GATGTGTTCCGTTTGCATGTTCGCA
>probe:Drosophila_2:1625197_at:455:489; Interrogation_Position=1988; Antisense; GTACTCACTCTCGAAGGATTTGCCA
>probe:Drosophila_2:1625197_at:699:21; Interrogation_Position=2056; Antisense; ATCATTTAGCAAAGTTTCGTCGAAC
>probe:Drosophila_2:1625197_at:3:587; Interrogation_Position=2113; Antisense; TGGACTTAGCACATGTATACGTATA

Paste this into a BLAST search page for me
AACTAAACGTTTGCAGTCCAGTCTGGTCCAGTCTGATATCATTCACGAATCTACACTTAGTTCCCGTTTGCAATAGCAATATACCGGCAAACCCATACTAGGAAACAGCAGCACGCTCCAAATTAAGAGAACATCTGACCGCCAATAACGTGACCGCCAATAACGTCGACTACTATCGACTACTACGACCTGCAGTGAGGTGGAGTTCCGCGGAGTTGATGCAACCAGAGATGCTTTGTGTGAATTCGGGGATGTGTTCCGTTTGCATGTTCGCAGTACTCACTCTCGAAGGATTTGCCAATCATTTAGCAAAGTTTCGTCGAACTGGACTTAGCACATGTATACGTATA

Full Affymetrix probeset data:

Annotations for 1625197_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime