FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625200_at:

>probe:Drosophila_2:1625200_at:37:51; Interrogation_Position=13; Antisense; ATGCCGAAAGATGGTCACTCACGTA
>probe:Drosophila_2:1625200_at:668:41; Interrogation_Position=148; Antisense; ATCGGTGCTTTGGTCAGCAACCTGC
>probe:Drosophila_2:1625200_at:337:631; Interrogation_Position=233; Antisense; TCGCGGTTAACCACAGGAATCCTCG
>probe:Drosophila_2:1625200_at:567:633; Interrogation_Position=255; Antisense; TCGCCAGCCACATCGGAGTTATGGG
>probe:Drosophila_2:1625200_at:82:703; Interrogation_Position=273; Antisense; TTATGGGACCGAGCGGAAGCCGCAC
>probe:Drosophila_2:1625200_at:40:625; Interrogation_Position=305; Antisense; TGCCCCGTTTCGTGATCAACATTGA
>probe:Drosophila_2:1625200_at:140:479; Interrogation_Position=428; Antisense; GTTTCAGTCACTTCAATCTGGCCCT
>probe:Drosophila_2:1625200_at:150:215; Interrogation_Position=46; Antisense; AAGAGGGCGTCCATCGCAGAGGAAA
>probe:Drosophila_2:1625200_at:67:51; Interrogation_Position=473; Antisense; ATGCCCACGTAAATGCCGATTATCC
>probe:Drosophila_2:1625200_at:218:47; Interrogation_Position=494; Antisense; ATCCTGGCTATGTTGGTGTTGTAAC
>probe:Drosophila_2:1625200_at:129:515; Interrogation_Position=509; Antisense; GTGTTGTAACCTTGTTGCTCTACCG
>probe:Drosophila_2:1625200_at:191:621; Interrogation_Position=524; Antisense; TGCTCTACCGCTTGTTGGATCCTAA
>probe:Drosophila_2:1625200_at:580:721; Interrogation_Position=558; Antisense; TTGGCCTAACCCCATGTGTACATAG
>probe:Drosophila_2:1625200_at:590:349; Interrogation_Position=61; Antisense; GCAGAGGAAACTCCTGTCTCCGATT

Paste this into a BLAST search page for me
ATGCCGAAAGATGGTCACTCACGTAATCGGTGCTTTGGTCAGCAACCTGCTCGCGGTTAACCACAGGAATCCTCGTCGCCAGCCACATCGGAGTTATGGGTTATGGGACCGAGCGGAAGCCGCACTGCCCCGTTTCGTGATCAACATTGAGTTTCAGTCACTTCAATCTGGCCCTAAGAGGGCGTCCATCGCAGAGGAAAATGCCCACGTAAATGCCGATTATCCATCCTGGCTATGTTGGTGTTGTAACGTGTTGTAACCTTGTTGCTCTACCGTGCTCTACCGCTTGTTGGATCCTAATTGGCCTAACCCCATGTGTACATAGGCAGAGGAAACTCCTGTCTCCGATT

Full Affymetrix probeset data:

Annotations for 1625200_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720