FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625203_at:

>probe:Drosophila_2:1625203_at:574:605; Interrogation_Position=1025; Antisense; TGATCGGCATTGGATTCCTCAGCGA
>probe:Drosophila_2:1625203_at:296:367; Interrogation_Position=1059; Antisense; GAATCTGGCTATCGTGCTGATGACC
>probe:Drosophila_2:1625203_at:321:415; Interrogation_Position=1106; Antisense; GAGCCACCATTGGTAGTTCCCTGAA
>probe:Drosophila_2:1625203_at:126:29; Interrogation_Position=1181; Antisense; ATACGGTGGCGAACGTTATTCCCAT
>probe:Drosophila_2:1625203_at:323:351; Interrogation_Position=1263; Antisense; GCAGATCGTCTTTGGACTGGCAGCT
>probe:Drosophila_2:1625203_at:233:143; Interrogation_Position=1278; Antisense; ACTGGCAGCTGTCATATTCTTCGTG
>probe:Drosophila_2:1625203_at:697:517; Interrogation_Position=1300; Antisense; GTGGGCAACGTGGTATTCATCATCT
>probe:Drosophila_2:1625203_at:450:447; Interrogation_Position=1351; Antisense; GATGCGGATGACTTCCTGAAGCCTA
>probe:Drosophila_2:1625203_at:142:113; Interrogation_Position=1454; Antisense; AGCAAATCAGTTGGCCGGAGCGGTA
>probe:Drosophila_2:1625203_at:349:119; Interrogation_Position=1472; Antisense; AGCGGTATACTGTCAAAGCCATCGA
>probe:Drosophila_2:1625203_at:628:63; Interrogation_Position=901; Antisense; ATGTGGCTGCTGTCCTATGTCTATC
>probe:Drosophila_2:1625203_at:99:683; Interrogation_Position=916; Antisense; TATGTCTATCTGATTGCCGCCGATG
>probe:Drosophila_2:1625203_at:579:201; Interrogation_Position=969; Antisense; AACCGCAGTGCGTAAGCTGTTCAAC
>probe:Drosophila_2:1625203_at:411:187; Interrogation_Position=991; Antisense; AACACGCTCTCGTTTTGGATTCCGG

Paste this into a BLAST search page for me
TGATCGGCATTGGATTCCTCAGCGAGAATCTGGCTATCGTGCTGATGACCGAGCCACCATTGGTAGTTCCCTGAAATACGGTGGCGAACGTTATTCCCATGCAGATCGTCTTTGGACTGGCAGCTACTGGCAGCTGTCATATTCTTCGTGGTGGGCAACGTGGTATTCATCATCTGATGCGGATGACTTCCTGAAGCCTAAGCAAATCAGTTGGCCGGAGCGGTAAGCGGTATACTGTCAAAGCCATCGAATGTGGCTGCTGTCCTATGTCTATCTATGTCTATCTGATTGCCGCCGATGAACCGCAGTGCGTAAGCTGTTCAACAACACGCTCTCGTTTTGGATTCCGG

Full Affymetrix probeset data:

Annotations for 1625203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720