Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625205_at:

>probe:Drosophila_2:1625205_at:42:387; Interrogation_Position=278; Antisense; GAAAACTTGTGGCTGCAACTCTCAC
>probe:Drosophila_2:1625205_at:625:395; Interrogation_Position=352; Antisense; GAAATAGATGCCCACCGCATATTTA
>probe:Drosophila_2:1625205_at:169:313; Interrogation_Position=380; Antisense; GCCAGACTTCGAGCTTTTCAAGAAA
>probe:Drosophila_2:1625205_at:469:385; Interrogation_Position=418; Antisense; GAAACACCTTCAGCGGACTGTACTG
>probe:Drosophila_2:1625205_at:321:723; Interrogation_Position=456; Antisense; TTGCTCTGACAACACACAGCTGTAC
>probe:Drosophila_2:1625205_at:62:679; Interrogation_Position=483; Antisense; TAGTGATCTTAATCTCTGCCTCAAC
>probe:Drosophila_2:1625205_at:243:251; Interrogation_Position=517; Antisense; CAAGGGTCCTGGTCGGACTGCAAGT
>probe:Drosophila_2:1625205_at:80:105; Interrogation_Position=553; Antisense; AGAAAGATTTGCACCCGGGATCCCT
>probe:Drosophila_2:1625205_at:385:307; Interrogation_Position=575; Antisense; CCTCAATTCGATCTGCTTGTCATTA
>probe:Drosophila_2:1625205_at:268:457; Interrogation_Position=607; Antisense; GATACTGCCGATTGCACACACAAAT
>probe:Drosophila_2:1625205_at:57:479; Interrogation_Position=642; Antisense; GTTTACTGGAACCTTGGCCAACATG
>probe:Drosophila_2:1625205_at:520:65; Interrogation_Position=705; Antisense; ATGGCAAACTCGAACCTGCGTTGAA
>probe:Drosophila_2:1625205_at:141:467; Interrogation_Position=724; Antisense; GTTGAACATCCGAATCACCAGTTTG
>probe:Drosophila_2:1625205_at:101:145; Interrogation_Position=778; Antisense; ACTGCGTTCCCGAATGTGGCATTAT

Paste this into a BLAST search page for me
GAAAACTTGTGGCTGCAACTCTCACGAAATAGATGCCCACCGCATATTTAGCCAGACTTCGAGCTTTTCAAGAAAGAAACACCTTCAGCGGACTGTACTGTTGCTCTGACAACACACAGCTGTACTAGTGATCTTAATCTCTGCCTCAACCAAGGGTCCTGGTCGGACTGCAAGTAGAAAGATTTGCACCCGGGATCCCTCCTCAATTCGATCTGCTTGTCATTAGATACTGCCGATTGCACACACAAATGTTTACTGGAACCTTGGCCAACATGATGGCAAACTCGAACCTGCGTTGAAGTTGAACATCCGAATCACCAGTTTGACTGCGTTCCCGAATGTGGCATTAT

Full Affymetrix probeset data:

Annotations for 1625205_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime