Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625207_at:

>probe:Drosophila_2:1625207_at:170:291; Interrogation_Position=1087; Antisense; CGGTGACGGTTGACTCTCTATTGAG
>probe:Drosophila_2:1625207_at:421:521; Interrogation_Position=1111; Antisense; GGGCGTTGCAAATGTCATTGTCGGT
>probe:Drosophila_2:1625207_at:165:291; Interrogation_Position=1132; Antisense; CGGTGACTTTCGATGGCTGTGATTC
>probe:Drosophila_2:1625207_at:652:149; Interrogation_Position=1163; Antisense; ACATAGCCATTTCCAATTCCCGGGT
>probe:Drosophila_2:1625207_at:250:247; Interrogation_Position=1177; Antisense; AATTCCCGGGTCCAGATCGATGATT
>probe:Drosophila_2:1625207_at:483:449; Interrogation_Position=1191; Antisense; GATCGATGATTATTGGTTGGCTGAA
>probe:Drosophila_2:1625207_at:651:175; Interrogation_Position=1236; Antisense; AAACCCAGCCGAGTTGCTGTTGCAA
>probe:Drosophila_2:1625207_at:421:505; Interrogation_Position=1271; Antisense; GTGGGAAATGCCTGTGATATTCACG
>probe:Drosophila_2:1625207_at:390:257; Interrogation_Position=1292; Antisense; CACGATTGGCCAATTGTCGGCAGTT
>probe:Drosophila_2:1625207_at:331:499; Interrogation_Position=1307; Antisense; GTCGGCAGTTCGATGTATCCGGAAA
>probe:Drosophila_2:1625207_at:274:489; Interrogation_Position=1336; Antisense; GTACATGCATATACAGCTGCGGGAG
>probe:Drosophila_2:1625207_at:653:609; Interrogation_Position=1400; Antisense; TAATTAATTGCTCTCTGCTTAACAA
>probe:Drosophila_2:1625207_at:376:419; Interrogation_Position=905; Antisense; GAGCTCGCTTGCCAAGCTGTACAGA
>probe:Drosophila_2:1625207_at:422:135; Interrogation_Position=933; Antisense; ACGCTCTATTCATATTGTTCATCAG

Paste this into a BLAST search page for me
CGGTGACGGTTGACTCTCTATTGAGGGGCGTTGCAAATGTCATTGTCGGTCGGTGACTTTCGATGGCTGTGATTCACATAGCCATTTCCAATTCCCGGGTAATTCCCGGGTCCAGATCGATGATTGATCGATGATTATTGGTTGGCTGAAAAACCCAGCCGAGTTGCTGTTGCAAGTGGGAAATGCCTGTGATATTCACGCACGATTGGCCAATTGTCGGCAGTTGTCGGCAGTTCGATGTATCCGGAAAGTACATGCATATACAGCTGCGGGAGTAATTAATTGCTCTCTGCTTAACAAGAGCTCGCTTGCCAAGCTGTACAGAACGCTCTATTCATATTGTTCATCAG

Full Affymetrix probeset data:

Annotations for 1625207_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime