Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625211_s_at:

>probe:Drosophila_2:1625211_s_at:136:631; Interrogation_Position=111; Antisense; TCCTGTATCCTGTATTCTGCAGCCG
>probe:Drosophila_2:1625211_s_at:536:683; Interrogation_Position=116; Antisense; TATCCTGTATTCTGCAGCCGCGGAT
>probe:Drosophila_2:1625211_s_at:137:59; Interrogation_Position=13; Antisense; ATGATCCAGAACGTCGCCACCTACT
>probe:Drosophila_2:1625211_s_at:569:261; Interrogation_Position=154; Antisense; CAGAACCCGGCTGTCGCTGGAGCTG
>probe:Drosophila_2:1625211_s_at:404:287; Interrogation_Position=182; Antisense; CTGGATCGGATCCTGGATGCTGCTC
>probe:Drosophila_2:1625211_s_at:443:631; Interrogation_Position=192; Antisense; TCCTGGATGCTGCTCCCTCAAATAA
>probe:Drosophila_2:1625211_s_at:273:309; Interrogation_Position=29; Antisense; CCACCTACTCGTACCCATTTTGTAT
>probe:Drosophila_2:1625211_s_at:152:277; Interrogation_Position=33; Antisense; CTACTCGTACCCATTTTGTATCCAT
>probe:Drosophila_2:1625211_s_at:100:145; Interrogation_Position=35; Antisense; ACTCGTACCCATTTTGTATCCATTT
>probe:Drosophila_2:1625211_s_at:455:47; Interrogation_Position=52; Antisense; ATCCATTTTGACTTATTTTACGAGC
>probe:Drosophila_2:1625211_s_at:613:721; Interrogation_Position=59; Antisense; TTGACTTATTTTACGAGCACAGCTG
>probe:Drosophila_2:1625211_s_at:78:597; Interrogation_Position=86; Antisense; TGTGCCCCGTACCTTGTACCCTGTA
>probe:Drosophila_2:1625211_s_at:708:487; Interrogation_Position=94; Antisense; GTACCTTGTACCCTGTATCCTGTAT
>probe:Drosophila_2:1625211_s_at:636:671; Interrogation_Position=95; Antisense; TACCTTGTACCCTGTATCCTGTATC

Paste this into a BLAST search page for me
TCCTGTATCCTGTATTCTGCAGCCGTATCCTGTATTCTGCAGCCGCGGATATGATCCAGAACGTCGCCACCTACTCAGAACCCGGCTGTCGCTGGAGCTGCTGGATCGGATCCTGGATGCTGCTCTCCTGGATGCTGCTCCCTCAAATAACCACCTACTCGTACCCATTTTGTATCTACTCGTACCCATTTTGTATCCATACTCGTACCCATTTTGTATCCATTTATCCATTTTGACTTATTTTACGAGCTTGACTTATTTTACGAGCACAGCTGTGTGCCCCGTACCTTGTACCCTGTAGTACCTTGTACCCTGTATCCTGTATTACCTTGTACCCTGTATCCTGTATC

Full Affymetrix probeset data:

Annotations for 1625211_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime