FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625212_at:

>probe:Drosophila_2:1625212_at:729:339; Interrogation_Position=236; Antisense; GCTACCCAGCTAAATCCTACAATGT
>probe:Drosophila_2:1625212_at:331:623; Interrogation_Position=260; Antisense; TGCGAGTGGGCAGCATTCAGCGACT
>probe:Drosophila_2:1625212_at:666:535; Interrogation_Position=300; Antisense; GGTGCCTCTGTCCAAGATCATAATC
>probe:Drosophila_2:1625212_at:146:31; Interrogation_Position=319; Antisense; ATAATCCACACGAACTACTCCAGTT
>probe:Drosophila_2:1625212_at:402:629; Interrogation_Position=337; Antisense; TCCAGTTCGGATGCAGTTGGCTCTA
>probe:Drosophila_2:1625212_at:531:337; Interrogation_Position=356; Antisense; GCTCTAATGACTTGGCCTTGCTGGA
>probe:Drosophila_2:1625212_at:490:175; Interrogation_Position=386; Antisense; AAACGTCGGTGGTCCTGAATGCGAA
>probe:Drosophila_2:1625212_at:478:235; Interrogation_Position=415; Antisense; AATCCGATTGATTTGGCCACCGAGC
>probe:Drosophila_2:1625212_at:237:79; Interrogation_Position=488; Antisense; AGGTGGACGGATCTCTCAGTCATGT
>probe:Drosophila_2:1625212_at:729:153; Interrogation_Position=531; Antisense; ACAGAGCCTGAGTGCGTCCGATTGC
>probe:Drosophila_2:1625212_at:282:465; Interrogation_Position=550; Antisense; GATTGCCAAACGGAGCTGTACCTGC
>probe:Drosophila_2:1625212_at:290:77; Interrogation_Position=578; Antisense; AGGAGGATCTGCTCTGTTTGTCCCC
>probe:Drosophila_2:1625212_at:455:571; Interrogation_Position=648; Antisense; TCCGGCGTCTTACAACAACCAATTG
>probe:Drosophila_2:1625212_at:391:125; Interrogation_Position=716; Antisense; AGCCCGATGGCTACGTGGATGTGAC

Paste this into a BLAST search page for me
GCTACCCAGCTAAATCCTACAATGTTGCGAGTGGGCAGCATTCAGCGACTGGTGCCTCTGTCCAAGATCATAATCATAATCCACACGAACTACTCCAGTTTCCAGTTCGGATGCAGTTGGCTCTAGCTCTAATGACTTGGCCTTGCTGGAAAACGTCGGTGGTCCTGAATGCGAAAATCCGATTGATTTGGCCACCGAGCAGGTGGACGGATCTCTCAGTCATGTACAGAGCCTGAGTGCGTCCGATTGCGATTGCCAAACGGAGCTGTACCTGCAGGAGGATCTGCTCTGTTTGTCCCCTCCGGCGTCTTACAACAACCAATTGAGCCCGATGGCTACGTGGATGTGAC

Full Affymetrix probeset data:

Annotations for 1625212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720