FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625214_at:

>probe:Drosophila_2:1625214_at:511:385; Interrogation_Position=501; Antisense; GAACAAGATGGCAGGCGTGAGCAAT
>probe:Drosophila_2:1625214_at:562:291; Interrogation_Position=516; Antisense; CGTGAGCAATGTAAAGGAGCCCCTT
>probe:Drosophila_2:1625214_at:419:247; Interrogation_Position=521; Antisense; GCAATGTAAAGGAGCCCCTTGGGCT
>probe:Drosophila_2:1625214_at:467:307; Interrogation_Position=537; Antisense; CCTTGGGCTCTGTCCAAACGAGATT
>probe:Drosophila_2:1625214_at:205:595; Interrogation_Position=540; Antisense; TGGGCTCTGTCCAAACGAGATTAAG
>probe:Drosophila_2:1625214_at:632:255; Interrogation_Position=551; Antisense; CAAACGAGATTAAGGAGGAGCAGCA
>probe:Drosophila_2:1625214_at:562:113; Interrogation_Position=569; Antisense; AGCAGCAGGCGTGCTCCAAACTCGA
>probe:Drosophila_2:1625214_at:91:509; Interrogation_Position=579; Antisense; GTGCTCCAAACTCGATTCACGCAAT
>probe:Drosophila_2:1625214_at:730:177; Interrogation_Position=586; Antisense; AAACTCGATTCACGCAATCCGATCA
>probe:Drosophila_2:1625214_at:163:463; Interrogation_Position=592; Antisense; GATTCACGCAATCCGATCACGGGCC
>probe:Drosophila_2:1625214_at:672:315; Interrogation_Position=614; Antisense; GCCTCGGCCTCAACGGAGATGGTGT
>probe:Drosophila_2:1625214_at:124:515; Interrogation_Position=635; Antisense; GTGTTGGCGGCCTCAAGCCCAAGAA
>probe:Drosophila_2:1625214_at:663:577; Interrogation_Position=643; Antisense; GGCCTCAAGCCCAAGAAGCTAAAGA
>probe:Drosophila_2:1625214_at:623:647; Interrogation_Position=662; Antisense; TAAAGATCCGAGAGGGCAACCCCGT

Paste this into a BLAST search page for me
GAACAAGATGGCAGGCGTGAGCAATCGTGAGCAATGTAAAGGAGCCCCTTGCAATGTAAAGGAGCCCCTTGGGCTCCTTGGGCTCTGTCCAAACGAGATTTGGGCTCTGTCCAAACGAGATTAAGCAAACGAGATTAAGGAGGAGCAGCAAGCAGCAGGCGTGCTCCAAACTCGAGTGCTCCAAACTCGATTCACGCAATAAACTCGATTCACGCAATCCGATCAGATTCACGCAATCCGATCACGGGCCGCCTCGGCCTCAACGGAGATGGTGTGTGTTGGCGGCCTCAAGCCCAAGAAGGCCTCAAGCCCAAGAAGCTAAAGATAAAGATCCGAGAGGGCAACCCCGT

Full Affymetrix probeset data:

Annotations for 1625214_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720