FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625216_at:

>probe:Drosophila_2:1625216_at:159:185; Interrogation_Position=1130; Antisense; AAAAGGAGTACCTCAGCCACGTCGG
>probe:Drosophila_2:1625216_at:194:313; Interrogation_Position=1154; Antisense; GCCAGGTGCTGTATCCGTTTGTAAA
>probe:Drosophila_2:1625216_at:27:601; Interrogation_Position=1173; Antisense; TGTAAAGTTCGTGGCCTTCTTCACA
>probe:Drosophila_2:1625216_at:613:541; Interrogation_Position=1258; Antisense; GGATTCTTTGGCTTTGTAGCTCTCA
>probe:Drosophila_2:1625216_at:456:487; Interrogation_Position=1273; Antisense; GTAGCTCTCAGTGTGCTGGTCAAGC
>probe:Drosophila_2:1625216_at:241:203; Interrogation_Position=1294; Antisense; AAGCCCTTCCTGCATCTGGTGTTTG
>probe:Drosophila_2:1625216_at:68:295; Interrogation_Position=1344; Antisense; CGATCGCAAGAGGTGGCTGGCCCAA
>probe:Drosophila_2:1625216_at:185:551; Interrogation_Position=1377; Antisense; GGAGAAGCTTAAGCTGGCCCTGCGT
>probe:Drosophila_2:1625216_at:44:209; Interrogation_Position=1417; Antisense; AAGCACTTTTACCAGCAGGGTCCGG
>probe:Drosophila_2:1625216_at:83:615; Interrogation_Position=1460; Antisense; TGAAGCTTCGTCCAGTGGGTCACTG
>probe:Drosophila_2:1625216_at:713:607; Interrogation_Position=1506; Antisense; TGAGACACAGATGCCTCGACCATTT
>probe:Drosophila_2:1625216_at:691:87; Interrogation_Position=1582; Antisense; AGTCGTTATAATCCTTTGCTACCTG
>probe:Drosophila_2:1625216_at:481:257; Interrogation_Position=1612; Antisense; CACAAGGCTCTTCGCTATGATCATT
>probe:Drosophila_2:1625216_at:37:681; Interrogation_Position=1627; Antisense; TATGATCATTCGGACCAGCCTGGAA

Paste this into a BLAST search page for me
AAAAGGAGTACCTCAGCCACGTCGGGCCAGGTGCTGTATCCGTTTGTAAATGTAAAGTTCGTGGCCTTCTTCACAGGATTCTTTGGCTTTGTAGCTCTCAGTAGCTCTCAGTGTGCTGGTCAAGCAAGCCCTTCCTGCATCTGGTGTTTGCGATCGCAAGAGGTGGCTGGCCCAAGGAGAAGCTTAAGCTGGCCCTGCGTAAGCACTTTTACCAGCAGGGTCCGGTGAAGCTTCGTCCAGTGGGTCACTGTGAGACACAGATGCCTCGACCATTTAGTCGTTATAATCCTTTGCTACCTGCACAAGGCTCTTCGCTATGATCATTTATGATCATTCGGACCAGCCTGGAA

Full Affymetrix probeset data:

Annotations for 1625216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720