FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625217_at:

>probe:Drosophila_2:1625217_at:287:131; Interrogation_Position=1521; Antisense; ACCTCGCTGGTCATTCACGTGAAGG
>probe:Drosophila_2:1625217_at:281:417; Interrogation_Position=1545; Antisense; GAGCGCTCTCTTAAATGCATTTGTC
>probe:Drosophila_2:1625217_at:671:341; Interrogation_Position=1561; Antisense; GCATTTGTCGCGATGGACGTGTTAT
>probe:Drosophila_2:1625217_at:722:407; Interrogation_Position=1576; Antisense; GACGTGTTATGCGACTGTCCTACGA
>probe:Drosophila_2:1625217_at:23:89; Interrogation_Position=1665; Antisense; AGTCTAGCGCGCTGCATGTCCTGGA
>probe:Drosophila_2:1625217_at:444:61; Interrogation_Position=1680; Antisense; ATGTCCTGGACCGTGCTGTCGAACA
>probe:Drosophila_2:1625217_at:406:285; Interrogation_Position=1695; Antisense; CTGTCGAACAGCAACCACTTGGGTA
>probe:Drosophila_2:1625217_at:384:347; Interrogation_Position=1764; Antisense; GCATCTCCCAATAGCGATCGCATGA
>probe:Drosophila_2:1625217_at:646:347; Interrogation_Position=1783; Antisense; GCATGATTGCCGTTCAGATTCGCTG
>probe:Drosophila_2:1625217_at:457:85; Interrogation_Position=1845; Antisense; AGTCCACGACAGGATTTCTTTCCCA
>probe:Drosophila_2:1625217_at:442:265; Interrogation_Position=1868; Antisense; CAGTCCACTGGTGCCGGAAAAGCTA
>probe:Drosophila_2:1625217_at:382:169; Interrogation_Position=1963; Antisense; AAATGGAGTTTCTGATGGCCTCGCT
>probe:Drosophila_2:1625217_at:479:607; Interrogation_Position=1975; Antisense; TGATGGCCTCGCTGACAAGTAACAC
>probe:Drosophila_2:1625217_at:375:495; Interrogation_Position=2013; Antisense; GTCACATGCATACCCACTAGATTGT

Paste this into a BLAST search page for me
ACCTCGCTGGTCATTCACGTGAAGGGAGCGCTCTCTTAAATGCATTTGTCGCATTTGTCGCGATGGACGTGTTATGACGTGTTATGCGACTGTCCTACGAAGTCTAGCGCGCTGCATGTCCTGGAATGTCCTGGACCGTGCTGTCGAACACTGTCGAACAGCAACCACTTGGGTAGCATCTCCCAATAGCGATCGCATGAGCATGATTGCCGTTCAGATTCGCTGAGTCCACGACAGGATTTCTTTCCCACAGTCCACTGGTGCCGGAAAAGCTAAAATGGAGTTTCTGATGGCCTCGCTTGATGGCCTCGCTGACAAGTAACACGTCACATGCATACCCACTAGATTGT

Full Affymetrix probeset data:

Annotations for 1625217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720