FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625218_at:

>probe:Drosophila_2:1625218_at:354:539; Interrogation_Position=3699; Antisense; GGTACTGTTCTCTATCCTTGTTTCA
>probe:Drosophila_2:1625218_at:350:45; Interrogation_Position=3712; Antisense; ATCCTTGTTTCAGGGTATTTCGCAA
>probe:Drosophila_2:1625218_at:168:531; Interrogation_Position=3724; Antisense; GGGTATTTCGCAATGGTTTGTCCAT
>probe:Drosophila_2:1625218_at:374:645; Interrogation_Position=3781; Antisense; TCATGTGAACTGTGAAGCCCTTAAC
>probe:Drosophila_2:1625218_at:78:123; Interrogation_Position=3796; Antisense; AGCCCTTAACAATCGTTTGTGAGAA
>probe:Drosophila_2:1625218_at:319:233; Interrogation_Position=3940; Antisense; AATGCGCAGAGAACCAAATTTGTAA
>probe:Drosophila_2:1625218_at:2:175; Interrogation_Position=3973; Antisense; AAACCATAACTAGGCACCGCACAAT
>probe:Drosophila_2:1625218_at:690:709; Interrogation_Position=4018; Antisense; TTAAGGATCTGGGTGGAGTCTTCAA
>probe:Drosophila_2:1625218_at:33:275; Interrogation_Position=4047; Antisense; CTTGTAGGCAAAACCTCGAGGTGCT
>probe:Drosophila_2:1625218_at:66:633; Interrogation_Position=4071; Antisense; TCCGCCCGGCATAATCTTAAATCAA
>probe:Drosophila_2:1625218_at:667:87; Interrogation_Position=4125; Antisense; AGTAGCACTCGGCAAAATTTTTAGA
>probe:Drosophila_2:1625218_at:701:367; Interrogation_Position=4148; Antisense; GAATCCAATTATCGTCTAAGTCGAA
>probe:Drosophila_2:1625218_at:93:701; Interrogation_Position=4174; Antisense; TTTATTGTCTAAACCGATATGCTAT
>probe:Drosophila_2:1625218_at:431:343; Interrogation_Position=4239; Antisense; GCATTTTTGCGCTTAATTAAACAGT

Paste this into a BLAST search page for me
GGTACTGTTCTCTATCCTTGTTTCAATCCTTGTTTCAGGGTATTTCGCAAGGGTATTTCGCAATGGTTTGTCCATTCATGTGAACTGTGAAGCCCTTAACAGCCCTTAACAATCGTTTGTGAGAAAATGCGCAGAGAACCAAATTTGTAAAAACCATAACTAGGCACCGCACAATTTAAGGATCTGGGTGGAGTCTTCAACTTGTAGGCAAAACCTCGAGGTGCTTCCGCCCGGCATAATCTTAAATCAAAGTAGCACTCGGCAAAATTTTTAGAGAATCCAATTATCGTCTAAGTCGAATTTATTGTCTAAACCGATATGCTATGCATTTTTGCGCTTAATTAAACAGT

Full Affymetrix probeset data:

Annotations for 1625218_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720