Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625219_at:

>probe:Drosophila_2:1625219_at:516:443; Interrogation_Position=3485; Antisense; GATGTTCCTCGAGGCCAGAATGGAT
>probe:Drosophila_2:1625219_at:550:363; Interrogation_Position=3561; Antisense; GAATAGGCCCCTACTATATACCATT
>probe:Drosophila_2:1625219_at:724:191; Interrogation_Position=3660; Antisense; AACCAGCTATCATCTAGTCTAGGGC
>probe:Drosophila_2:1625219_at:349:675; Interrogation_Position=3679; Antisense; TAGGGCCTCGGCAAACCACTTAAGC
>probe:Drosophila_2:1625219_at:548:273; Interrogation_Position=3697; Antisense; CTTAAGCCGCTTAGTGGTGTCCAAT
>probe:Drosophila_2:1625219_at:2:517; Interrogation_Position=3713; Antisense; GTGTCCAATGTGGATACCATCCCAC
>probe:Drosophila_2:1625219_at:86:291; Interrogation_Position=3752; Antisense; CGGTTGTGTTCTCCATCTGATGCAA
>probe:Drosophila_2:1625219_at:630:39; Interrogation_Position=3766; Antisense; ATCTGATGCAACCAATCGGCTTATA
>probe:Drosophila_2:1625219_at:654:639; Interrogation_Position=3781; Antisense; TCGGCTTATAGCTGTCTGAGACATA
>probe:Drosophila_2:1625219_at:277:151; Interrogation_Position=3801; Antisense; ACATAACACTTAACATCGACGGCCC
>probe:Drosophila_2:1625219_at:415:41; Interrogation_Position=3815; Antisense; ATCGACGGCCCCTGCGAAAAGAGAT
>probe:Drosophila_2:1625219_at:636:245; Interrogation_Position=3882; Antisense; AATTAAGGTGACTTCCCTCTCATTC
>probe:Drosophila_2:1625219_at:38:307; Interrogation_Position=3923; Antisense; GCCGCGACCGCTTTTCAAATGGGTT
>probe:Drosophila_2:1625219_at:667:645; Interrogation_Position=3937; Antisense; TCAAATGGGTTACTCTAACGGCCTT

Paste this into a BLAST search page for me
GATGTTCCTCGAGGCCAGAATGGATGAATAGGCCCCTACTATATACCATTAACCAGCTATCATCTAGTCTAGGGCTAGGGCCTCGGCAAACCACTTAAGCCTTAAGCCGCTTAGTGGTGTCCAATGTGTCCAATGTGGATACCATCCCACCGGTTGTGTTCTCCATCTGATGCAAATCTGATGCAACCAATCGGCTTATATCGGCTTATAGCTGTCTGAGACATAACATAACACTTAACATCGACGGCCCATCGACGGCCCCTGCGAAAAGAGATAATTAAGGTGACTTCCCTCTCATTCGCCGCGACCGCTTTTCAAATGGGTTTCAAATGGGTTACTCTAACGGCCTT

Full Affymetrix probeset data:

Annotations for 1625219_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime