FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625222_at:

>probe:Drosophila_2:1625222_at:111:253; Interrogation_Position=1023; Antisense; CAAGTTTCGGTTTCAGCTGTGTGGT
>probe:Drosophila_2:1625222_at:10:499; Interrogation_Position=1046; Antisense; GTCTCTTTTCCATTAACCACAACAT
>probe:Drosophila_2:1625222_at:274:673; Interrogation_Position=1111; Antisense; TACCTGCTTCAGTTTGACTTCATGA
>probe:Drosophila_2:1625222_at:569:297; Interrogation_Position=587; Antisense; CCGAAATCATTTTGGTCTACCGCTA
>probe:Drosophila_2:1625222_at:128:643; Interrogation_Position=602; Antisense; TCTACCGCTATGTGTGGCTGGTCAA
>probe:Drosophila_2:1625222_at:588:209; Interrogation_Position=663; Antisense; AAGAATTCACGCACTAGCATCCTTG
>probe:Drosophila_2:1625222_at:256:601; Interrogation_Position=686; Antisense; TGTACGATCGCCTGCTGAAGCTGAG
>probe:Drosophila_2:1625222_at:381:509; Interrogation_Position=781; Antisense; GTGCAAATCTTTTTCCTCATTGTGC
>probe:Drosophila_2:1625222_at:31:483; Interrogation_Position=828; Antisense; GTATATTTACTTAGTGGCTTCCCCA
>probe:Drosophila_2:1625222_at:253:571; Interrogation_Position=843; Antisense; GGCTTCCCCACAATTGATCATCAAT
>probe:Drosophila_2:1625222_at:543:33; Interrogation_Position=862; Antisense; ATCAATTTCTGGGACTTCTGGCTGA
>probe:Drosophila_2:1625222_at:573:639; Interrogation_Position=890; Antisense; TCGTGGTGTGTGATCTTGCCGGAAA
>probe:Drosophila_2:1625222_at:530:143; Interrogation_Position=945; Antisense; ACTGTTCACTGATCTGGAGCACGAC
>probe:Drosophila_2:1625222_at:32:233; Interrogation_Position=994; Antisense; AATGAATTCGCATGGCTGTGCACCC

Paste this into a BLAST search page for me
CAAGTTTCGGTTTCAGCTGTGTGGTGTCTCTTTTCCATTAACCACAACATTACCTGCTTCAGTTTGACTTCATGACCGAAATCATTTTGGTCTACCGCTATCTACCGCTATGTGTGGCTGGTCAAAAGAATTCACGCACTAGCATCCTTGTGTACGATCGCCTGCTGAAGCTGAGGTGCAAATCTTTTTCCTCATTGTGCGTATATTTACTTAGTGGCTTCCCCAGGCTTCCCCACAATTGATCATCAATATCAATTTCTGGGACTTCTGGCTGATCGTGGTGTGTGATCTTGCCGGAAAACTGTTCACTGATCTGGAGCACGACAATGAATTCGCATGGCTGTGCACCC

Full Affymetrix probeset data:

Annotations for 1625222_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720