FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625227_at:

>probe:Drosophila_2:1625227_at:620:617; Interrogation_Position=1812; Antisense; TGCAGGAACGCTACTCTCGAGAGAA
>probe:Drosophila_2:1625227_at:625:425; Interrogation_Position=1830; Antisense; GAGAGAATGACCACCTGCATCGCAA
>probe:Drosophila_2:1625227_at:402:361; Interrogation_Position=1851; Antisense; GCAAGGCACCCAGTTTTTCGCTGTA
>probe:Drosophila_2:1625227_at:249:235; Interrogation_Position=1886; Antisense; AATCGCTTCAGCTCAGATAGTGGAA
>probe:Drosophila_2:1625227_at:379:457; Interrogation_Position=1946; Antisense; GATACGATCAGCAATAGGACCACTT
>probe:Drosophila_2:1625227_at:680:413; Interrogation_Position=1963; Antisense; GACCACTTGGTATGCGGCCACGTAA
>probe:Drosophila_2:1625227_at:204:101; Interrogation_Position=2013; Antisense; AGAGGATCCTTGTCCGGCTAATGAA
>probe:Drosophila_2:1625227_at:577:657; Interrogation_Position=2062; Antisense; TAAGGAATCCAGTCCAATTACATCT
>probe:Drosophila_2:1625227_at:606:13; Interrogation_Position=2078; Antisense; ATTACATCTGGAGCTGCCAGTGGCG
>probe:Drosophila_2:1625227_at:478:7; Interrogation_Position=2153; Antisense; ATTGCTGCTCATTGTTTGTGGCACA
>probe:Drosophila_2:1625227_at:647:549; Interrogation_Position=2179; Antisense; GGAGATCGGGAGTCGAACGCCTTTC
>probe:Drosophila_2:1625227_at:611:381; Interrogation_Position=2193; Antisense; GAACGCCTTTCGCTTTGAATGCTAA
>probe:Drosophila_2:1625227_at:569:203; Interrogation_Position=2290; Antisense; AAGCGCAACGCGTTGAACGTTTACT
>probe:Drosophila_2:1625227_at:34:195; Interrogation_Position=2305; Antisense; AACGTTTACTTGTGCCTAGCTGGAT

Paste this into a BLAST search page for me
TGCAGGAACGCTACTCTCGAGAGAAGAGAGAATGACCACCTGCATCGCAAGCAAGGCACCCAGTTTTTCGCTGTAAATCGCTTCAGCTCAGATAGTGGAAGATACGATCAGCAATAGGACCACTTGACCACTTGGTATGCGGCCACGTAAAGAGGATCCTTGTCCGGCTAATGAATAAGGAATCCAGTCCAATTACATCTATTACATCTGGAGCTGCCAGTGGCGATTGCTGCTCATTGTTTGTGGCACAGGAGATCGGGAGTCGAACGCCTTTCGAACGCCTTTCGCTTTGAATGCTAAAAGCGCAACGCGTTGAACGTTTACTAACGTTTACTTGTGCCTAGCTGGAT

Full Affymetrix probeset data:

Annotations for 1625227_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720