FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625233_at:

>probe:Drosophila_2:1625233_at:531:709; Interrogation_Position=1320; Antisense; TTAATTGTCCTCTACTACTATCAGT
>probe:Drosophila_2:1625233_at:562:209; Interrogation_Position=1369; Antisense; AAGCAACTACTTTACACCCACAACA
>probe:Drosophila_2:1625233_at:303:695; Interrogation_Position=1412; Antisense; TTTCGGTTCAGATTGGTTCGTTTCG
>probe:Drosophila_2:1625233_at:41:471; Interrogation_Position=1427; Antisense; GTTCGTTTCGGAGGCAATGACAGAT
>probe:Drosophila_2:1625233_at:647:105; Interrogation_Position=1465; Antisense; AGCACTTACTTAGACCACCTTATTA
>probe:Drosophila_2:1625233_at:271:63; Interrogation_Position=1526; Antisense; ATGTGCCCTCATATCGAAATTCGTG
>probe:Drosophila_2:1625233_at:60:507; Interrogation_Position=1548; Antisense; GTGCCTTCCGCTATTGCCGGAATAA
>probe:Drosophila_2:1625233_at:27:497; Interrogation_Position=1580; Antisense; GTCAGCTTATATATCGATGTCCAAA
>probe:Drosophila_2:1625233_at:322:167; Interrogation_Position=1603; Antisense; AAATGTCGTATTCAACTAGTTCGCA
>probe:Drosophila_2:1625233_at:243:591; Interrogation_Position=1639; Antisense; TGGTTTCTATGTATATTCCCGCGAC
>probe:Drosophila_2:1625233_at:195:687; Interrogation_Position=1652; Antisense; TATTCCCGCGACTGAAAACTTCAAA
>probe:Drosophila_2:1625233_at:423:679; Interrogation_Position=1729; Antisense; TAGTCACTTCTTTTTAATAACCATG
>probe:Drosophila_2:1625233_at:447:513; Interrogation_Position=1774; Antisense; GTGATTTGCTGCTACATATATCCAT
>probe:Drosophila_2:1625233_at:128:655; Interrogation_Position=1838; Antisense; TAATTCTATCGTGTACCATTGTGAG

Paste this into a BLAST search page for me
TTAATTGTCCTCTACTACTATCAGTAAGCAACTACTTTACACCCACAACATTTCGGTTCAGATTGGTTCGTTTCGGTTCGTTTCGGAGGCAATGACAGATAGCACTTACTTAGACCACCTTATTAATGTGCCCTCATATCGAAATTCGTGGTGCCTTCCGCTATTGCCGGAATAAGTCAGCTTATATATCGATGTCCAAAAAATGTCGTATTCAACTAGTTCGCATGGTTTCTATGTATATTCCCGCGACTATTCCCGCGACTGAAAACTTCAAATAGTCACTTCTTTTTAATAACCATGGTGATTTGCTGCTACATATATCCATTAATTCTATCGTGTACCATTGTGAG

Full Affymetrix probeset data:

Annotations for 1625233_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720