Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625235_at:

>probe:Drosophila_2:1625235_at:569:599; Interrogation_Position=2396; Antisense; TGTATCCGCCGTCCAAGTGGTCTGA
>probe:Drosophila_2:1625235_at:664:221; Interrogation_Position=2410; Antisense; AAGTGGTCTGATCCTGACGCGTCCA
>probe:Drosophila_2:1625235_at:530:573; Interrogation_Position=2438; Antisense; TGGCGGAGTCTTTTTACTACACTTT
>probe:Drosophila_2:1625235_at:186:605; Interrogation_Position=2498; Antisense; TGATCTTTGCCTGCGTTCAGGGATA
>probe:Drosophila_2:1625235_at:276:281; Interrogation_Position=2571; Antisense; CTCCAGGCTTTCGTATTCTGTTTTT
>probe:Drosophila_2:1625235_at:551:441; Interrogation_Position=2619; Antisense; GATGAACGCACGGAGTACCAGGACT
>probe:Drosophila_2:1625235_at:472:557; Interrogation_Position=2639; Antisense; GGACTAGCACATACTTCTCGGATTA
>probe:Drosophila_2:1625235_at:655:57; Interrogation_Position=2668; Antisense; ATGATGCTTAACTTCTGGTCGACCC
>probe:Drosophila_2:1625235_at:512:709; Interrogation_Position=2698; Antisense; TTCACCTTGCTGTTTTCCTATGCAA
>probe:Drosophila_2:1625235_at:150:53; Interrogation_Position=2722; Antisense; ATGCATCTGCTCATTGAGGCACCAA
>probe:Drosophila_2:1625235_at:275:433; Interrogation_Position=2737; Antisense; GAGGCACCAATTGGCGGACTTGACA
>probe:Drosophila_2:1625235_at:257:557; Interrogation_Position=2752; Antisense; GGACTTGACATTTTCCTAAGGCCAA
>probe:Drosophila_2:1625235_at:210:393; Interrogation_Position=2780; Antisense; GAAAGATCTCTCCTACCGAAAAACA
>probe:Drosophila_2:1625235_at:211:35; Interrogation_Position=2846; Antisense; ATCTGCTGGAACCTACAACTTCAAC

Paste this into a BLAST search page for me
TGTATCCGCCGTCCAAGTGGTCTGAAAGTGGTCTGATCCTGACGCGTCCATGGCGGAGTCTTTTTACTACACTTTTGATCTTTGCCTGCGTTCAGGGATACTCCAGGCTTTCGTATTCTGTTTTTGATGAACGCACGGAGTACCAGGACTGGACTAGCACATACTTCTCGGATTAATGATGCTTAACTTCTGGTCGACCCTTCACCTTGCTGTTTTCCTATGCAAATGCATCTGCTCATTGAGGCACCAAGAGGCACCAATTGGCGGACTTGACAGGACTTGACATTTTCCTAAGGCCAAGAAAGATCTCTCCTACCGAAAAACAATCTGCTGGAACCTACAACTTCAAC

Full Affymetrix probeset data:

Annotations for 1625235_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime