Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625236_s_at:

>probe:Drosophila_2:1625236_s_at:141:363; Interrogation_Position=458; Antisense; GAATTTTTGTTGTTTGGCCGGTGCG
>probe:Drosophila_2:1625236_s_at:482:699; Interrogation_Position=467; Antisense; TTGTTTGGCCGGTGCGTATGTGTTT
>probe:Drosophila_2:1625236_s_at:94:281; Interrogation_Position=524; Antisense; CTGCCAGTGTGTGTGAGCCTCTCGG
>probe:Drosophila_2:1625236_s_at:131:597; Interrogation_Position=533; Antisense; TGTGTGAGCCTCTCGGCAAAGGAGA
>probe:Drosophila_2:1625236_s_at:729:241; Interrogation_Position=554; Antisense; GAGAAAAACGCACAAGTCGGTAGGA
>probe:Drosophila_2:1625236_s_at:53:349; Interrogation_Position=620; Antisense; GCAGTAGGAATTTCTTGTTTCCCCA
>probe:Drosophila_2:1625236_s_at:342:685; Interrogation_Position=729; Antisense; TATCTGTGAAATAAACGGAGGCCGC
>probe:Drosophila_2:1625236_s_at:606:137; Interrogation_Position=743; Antisense; ACGGAGGCCGCAAAAAGTGGCACAA
>probe:Drosophila_2:1625236_s_at:78:221; Interrogation_Position=766; Antisense; AAGTGAAAATTCCTGCGCCGTTCGT
>probe:Drosophila_2:1625236_s_at:359:625; Interrogation_Position=779; Antisense; TGCGCCGTTCGTTTTATTATTATTT
>probe:Drosophila_2:1625236_s_at:314:15; Interrogation_Position=794; Antisense; ATTATTATTTTTCTGTTGCCGTCTT
>probe:Drosophila_2:1625236_s_at:632:469; Interrogation_Position=808; Antisense; GTTGCCGTCTTTTTGACAATCGCCA
>probe:Drosophila_2:1625236_s_at:86:439; Interrogation_Position=912; Antisense; GAGGAAGAGCAATCCCGATATAGAA
>probe:Drosophila_2:1625236_s_at:12:459; Interrogation_Position=928; Antisense; GATATAGAACTCGTCCTTTTTCGGC

Paste this into a BLAST search page for me
GAATTTTTGTTGTTTGGCCGGTGCGTTGTTTGGCCGGTGCGTATGTGTTTCTGCCAGTGTGTGTGAGCCTCTCGGTGTGTGAGCCTCTCGGCAAAGGAGAGAGAAAAACGCACAAGTCGGTAGGAGCAGTAGGAATTTCTTGTTTCCCCATATCTGTGAAATAAACGGAGGCCGCACGGAGGCCGCAAAAAGTGGCACAAAAGTGAAAATTCCTGCGCCGTTCGTTGCGCCGTTCGTTTTATTATTATTTATTATTATTTTTCTGTTGCCGTCTTGTTGCCGTCTTTTTGACAATCGCCAGAGGAAGAGCAATCCCGATATAGAAGATATAGAACTCGTCCTTTTTCGGC

Full Affymetrix probeset data:

Annotations for 1625236_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime