FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625237_at:

>probe:Drosophila_2:1625237_at:696:141; Interrogation_Position=1081; Antisense; ACTGGCTTCCGCGAGGAGGACATAA
>probe:Drosophila_2:1625237_at:345:415; Interrogation_Position=1150; Antisense; GACCACATCATGTTCTACACTACTT
>probe:Drosophila_2:1625237_at:632:311; Interrogation_Position=1193; Antisense; GCCGTGGGCTCGCACAGTTTAAAAA
>probe:Drosophila_2:1625237_at:368:205; Interrogation_Position=1216; Antisense; AAGCCGAGGTTGACCATTCACAGGA
>probe:Drosophila_2:1625237_at:470:419; Interrogation_Position=679; Antisense; GAGCAGCTGTATTGCCAGTGCCTCT
>probe:Drosophila_2:1625237_at:369:87; Interrogation_Position=695; Antisense; AGTGCCTCTGCCTAATGTCAAAGCT
>probe:Drosophila_2:1625237_at:595:243; Interrogation_Position=738; Antisense; AATTCTTTACAGCTCGAGTTCGTTC
>probe:Drosophila_2:1625237_at:88:149; Interrogation_Position=803; Antisense; ACTTTGCAGGTTACTTCGCCAGGGA
>probe:Drosophila_2:1625237_at:350:615; Interrogation_Position=851; Antisense; TGAATTGCATCCTTGTTTTACCGCC
>probe:Drosophila_2:1625237_at:292:477; Interrogation_Position=865; Antisense; GTTTTACCGCCCTATATGCGCAAGG
>probe:Drosophila_2:1625237_at:535:97; Interrogation_Position=923; Antisense; AGATCTCTCGCAGGGAGGCATGCAT
>probe:Drosophila_2:1625237_at:405:71; Interrogation_Position=938; Antisense; AGGCATGCATCGGAGGTCCCAAGAA
>probe:Drosophila_2:1625237_at:568:123; Interrogation_Position=962; Antisense; AGCCGCTGTCGAAAGTTGCCAGACT
>probe:Drosophila_2:1625237_at:525:719; Interrogation_Position=977; Antisense; TTGCCAGACTTTGTTACCTCAGCTA

Paste this into a BLAST search page for me
ACTGGCTTCCGCGAGGAGGACATAAGACCACATCATGTTCTACACTACTTGCCGTGGGCTCGCACAGTTTAAAAAAAGCCGAGGTTGACCATTCACAGGAGAGCAGCTGTATTGCCAGTGCCTCTAGTGCCTCTGCCTAATGTCAAAGCTAATTCTTTACAGCTCGAGTTCGTTCACTTTGCAGGTTACTTCGCCAGGGATGAATTGCATCCTTGTTTTACCGCCGTTTTACCGCCCTATATGCGCAAGGAGATCTCTCGCAGGGAGGCATGCATAGGCATGCATCGGAGGTCCCAAGAAAGCCGCTGTCGAAAGTTGCCAGACTTTGCCAGACTTTGTTACCTCAGCTA

Full Affymetrix probeset data:

Annotations for 1625237_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720