Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625238_at:

>probe:Drosophila_2:1625238_at:333:649; Interrogation_Position=1232; Antisense; TCAGGGCAATGCAAATCTTCCACAG
>probe:Drosophila_2:1625238_at:305:123; Interrogation_Position=1267; Antisense; AGCCTCCGGTGGTGAATCCTCCAAA
>probe:Drosophila_2:1625238_at:636:175; Interrogation_Position=1289; Antisense; AAACGGAGGTATCCTGCCGCCTCTG
>probe:Drosophila_2:1625238_at:270:593; Interrogation_Position=1312; Antisense; TGGGAACGGGCGGTATCTCCACCAG
>probe:Drosophila_2:1625238_at:117:573; Interrogation_Position=1360; Antisense; GGCTGCGAAACAACGGCCTAGGCAT
>probe:Drosophila_2:1625238_at:438:561; Interrogation_Position=1426; Antisense; GGCAACCTGGCCTCGTGGGTAACAA
>probe:Drosophila_2:1625238_at:219:385; Interrogation_Position=1469; Antisense; GAACTTCCGCACGAGCATTTTTGGC
>probe:Drosophila_2:1625238_at:424:713; Interrogation_Position=1489; Antisense; TTGGCGGTGGCTCAAATCGTCCCAA
>probe:Drosophila_2:1625238_at:389:335; Interrogation_Position=1517; Antisense; GCTGCGATCGCGTGGTCTAAAGTAT
>probe:Drosophila_2:1625238_at:307:529; Interrogation_Position=1598; Antisense; GGGAGATTACCATCAAAATTGCCAA
>probe:Drosophila_2:1625238_at:496:247; Interrogation_Position=1614; Antisense; AATTGCCAATCGAAGCCAGCATTGT
>probe:Drosophila_2:1625238_at:665:115; Interrogation_Position=1631; Antisense; AGCATTGTGGCTGCATTTATCCATA
>probe:Drosophila_2:1625238_at:235:239; Interrogation_Position=1725; Antisense; AATAGTGGTATGTTTTCCGATCAAA
>probe:Drosophila_2:1625238_at:360:493; Interrogation_Position=1772; Antisense; GTAAGCGCTATAAAACCCAATTGAT

Paste this into a BLAST search page for me
TCAGGGCAATGCAAATCTTCCACAGAGCCTCCGGTGGTGAATCCTCCAAAAAACGGAGGTATCCTGCCGCCTCTGTGGGAACGGGCGGTATCTCCACCAGGGCTGCGAAACAACGGCCTAGGCATGGCAACCTGGCCTCGTGGGTAACAAGAACTTCCGCACGAGCATTTTTGGCTTGGCGGTGGCTCAAATCGTCCCAAGCTGCGATCGCGTGGTCTAAAGTATGGGAGATTACCATCAAAATTGCCAAAATTGCCAATCGAAGCCAGCATTGTAGCATTGTGGCTGCATTTATCCATAAATAGTGGTATGTTTTCCGATCAAAGTAAGCGCTATAAAACCCAATTGAT

Full Affymetrix probeset data:

Annotations for 1625238_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime