FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625242_at:

>probe:Drosophila_2:1625242_at:145:59; Interrogation_Position=1093; Antisense; ATGTTTATTTATGATCCTCTTTCAA
>probe:Drosophila_2:1625242_at:226:445; Interrogation_Position=1120; Antisense; GATGCAATATTGTGTATGCCTATGT
>probe:Drosophila_2:1625242_at:243:685; Interrogation_Position=597; Antisense; TATCGCTCGCGTGGTGCACGAACGC
>probe:Drosophila_2:1625242_at:439:449; Interrogation_Position=640; Antisense; GATCGCAAGCCGGTAGTGGGTAAAC
>probe:Drosophila_2:1625242_at:405:157; Interrogation_Position=685; Antisense; AACGACGTCGTCTCGTCCAACGACT
>probe:Drosophila_2:1625242_at:113:587; Interrogation_Position=716; Antisense; TGGACCTGCCCATGCGCATACTACG
>probe:Drosophila_2:1625242_at:40:669; Interrogation_Position=734; Antisense; TACTACGTCTTCTCCAGATCCAGAG
>probe:Drosophila_2:1625242_at:37:99; Interrogation_Position=749; Antisense; AGATCCAGAGCCTACGCGAGCTGCA
>probe:Drosophila_2:1625242_at:225:419; Interrogation_Position=766; Antisense; GAGCTGCAGACACACATCAATGAGA
>probe:Drosophila_2:1625242_at:521:307; Interrogation_Position=791; Antisense; CCATTGTGGCGGTGCAGAACATCAC
>probe:Drosophila_2:1625242_at:73:385; Interrogation_Position=807; Antisense; GAACATCACGGCCAATCCAAAGACT
>probe:Drosophila_2:1625242_at:327:517; Interrogation_Position=850; Antisense; GTGGGATTCTAGACGATTAACAGTA
>probe:Drosophila_2:1625242_at:17:383; Interrogation_Position=878; Antisense; GAACGCAATCGACACAATATAACAT
>probe:Drosophila_2:1625242_at:172:457; Interrogation_Position=991; Antisense; GATAGATCAACAGCCAAGCTATGAA

Paste this into a BLAST search page for me
ATGTTTATTTATGATCCTCTTTCAAGATGCAATATTGTGTATGCCTATGTTATCGCTCGCGTGGTGCACGAACGCGATCGCAAGCCGGTAGTGGGTAAACAACGACGTCGTCTCGTCCAACGACTTGGACCTGCCCATGCGCATACTACGTACTACGTCTTCTCCAGATCCAGAGAGATCCAGAGCCTACGCGAGCTGCAGAGCTGCAGACACACATCAATGAGACCATTGTGGCGGTGCAGAACATCACGAACATCACGGCCAATCCAAAGACTGTGGGATTCTAGACGATTAACAGTAGAACGCAATCGACACAATATAACATGATAGATCAACAGCCAAGCTATGAA

Full Affymetrix probeset data:

Annotations for 1625242_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720