FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625244_at:

>probe:Drosophila_2:1625244_at:424:381; Interrogation_Position=1302; Antisense; GAACCCGCGAAGTTGGCATTCAGGA
>probe:Drosophila_2:1625244_at:464:393; Interrogation_Position=1325; Antisense; GAAATCCACAACAAGGTGCGCCCTT
>probe:Drosophila_2:1625244_at:559:507; Interrogation_Position=1340; Antisense; GTGCGCCCTTACGAAATTGAGCTAA
>probe:Drosophila_2:1625244_at:606:11; Interrogation_Position=1364; Antisense; ATTCGTCGGGACTATGTGGCCAATG
>probe:Drosophila_2:1625244_at:422:525; Interrogation_Position=1395; Antisense; GGGAAACGTTCCTCTCATACGAAGA
>probe:Drosophila_2:1625244_at:187:75; Interrogation_Position=1428; Antisense; AGGACATTCTCGTAGGCCTTCTTAG
>probe:Drosophila_2:1625244_at:546:705; Interrogation_Position=1449; Antisense; TTAGGCTGCGAAAGTGCTCACCGGA
>probe:Drosophila_2:1625244_at:188:195; Interrogation_Position=1488; Antisense; AACTGAAGGGCGAATGCTCCATTGT
>probe:Drosophila_2:1625244_at:265:687; Interrogation_Position=1527; Antisense; TATATGGCTCAGTCGTGCCGGTTAA
>probe:Drosophila_2:1625244_at:90:367; Interrogation_Position=1542; Antisense; TGCCGGTTAATGCTAGGGATCCCAC
>probe:Drosophila_2:1625244_at:566:677; Interrogation_Position=1555; Antisense; TAGGGATCCCACCAAGTTTCAGCAC
>probe:Drosophila_2:1625244_at:3:129; Interrogation_Position=1578; Antisense; ACCAGGGCTTCGGTATGTTGCTGAT
>probe:Drosophila_2:1625244_at:485:253; Interrogation_Position=1644; Antisense; CAAAACTGGCGGTCATATCGGGAGT
>probe:Drosophila_2:1625244_at:473:457; Interrogation_Position=1698; Antisense; GATACCAACTTGACGGACCCTACAT

Paste this into a BLAST search page for me
GAACCCGCGAAGTTGGCATTCAGGAGAAATCCACAACAAGGTGCGCCCTTGTGCGCCCTTACGAAATTGAGCTAAATTCGTCGGGACTATGTGGCCAATGGGGAAACGTTCCTCTCATACGAAGAAGGACATTCTCGTAGGCCTTCTTAGTTAGGCTGCGAAAGTGCTCACCGGAAACTGAAGGGCGAATGCTCCATTGTTATATGGCTCAGTCGTGCCGGTTAATGCCGGTTAATGCTAGGGATCCCACTAGGGATCCCACCAAGTTTCAGCACACCAGGGCTTCGGTATGTTGCTGATCAAAACTGGCGGTCATATCGGGAGTGATACCAACTTGACGGACCCTACAT

Full Affymetrix probeset data:

Annotations for 1625244_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720