FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625245_at:

>probe:Drosophila_2:1625245_at:294:549; Interrogation_Position=2747; Antisense; GGAGGCTATACCATCATCAGATTCG
>probe:Drosophila_2:1625245_at:129:95; Interrogation_Position=2765; Antisense; AGATTCGAGGCCTCTAATCCGGGCT
>probe:Drosophila_2:1625245_at:29:657; Interrogation_Position=2779; Antisense; TAATCCGGGCTATTGGCTTTTCCAT
>probe:Drosophila_2:1625245_at:176:571; Interrogation_Position=2793; Antisense; GGCTTTTCCATTGCCACATCGAATT
>probe:Drosophila_2:1625245_at:527:311; Interrogation_Position=2805; Antisense; GCCACATCGAATTCCATGCCGAGAT
>probe:Drosophila_2:1625245_at:641:451; Interrogation_Position=2827; Antisense; GATCGGTATGGCTCTGGTCTTCAAA
>probe:Drosophila_2:1625245_at:121:139; Interrogation_Position=2862; Antisense; ACGATCAAATGGTTCCGGTGCCAGA
>probe:Drosophila_2:1625245_at:601:305; Interrogation_Position=2898; Antisense; CCTGCGGCGATTATAATCCAGACTT
>probe:Drosophila_2:1625245_at:232:529; Interrogation_Position=2953; Antisense; GGGATCCAGCAAGCCGATAACAGCT
>probe:Drosophila_2:1625245_at:376:531; Interrogation_Position=3007; Antisense; GGGTCTGGAACCCACTTGGATTACA
>probe:Drosophila_2:1625245_at:416:645; Interrogation_Position=3060; Antisense; TCTATCGATAAGAGCTGGCCTTCAA
>probe:Drosophila_2:1625245_at:622:425; Interrogation_Position=3087; Antisense; GAGAGCACAATCCAAACTTGCCAAA
>probe:Drosophila_2:1625245_at:718:19; Interrogation_Position=3184; Antisense; ATATATTTGTTTTCCGGCACCTGTA
>probe:Drosophila_2:1625245_at:515:21; Interrogation_Position=3225; Antisense; ATATTCGCATCGTTGTAGCATAAGC

Paste this into a BLAST search page for me
GGAGGCTATACCATCATCAGATTCGAGATTCGAGGCCTCTAATCCGGGCTTAATCCGGGCTATTGGCTTTTCCATGGCTTTTCCATTGCCACATCGAATTGCCACATCGAATTCCATGCCGAGATGATCGGTATGGCTCTGGTCTTCAAAACGATCAAATGGTTCCGGTGCCAGACCTGCGGCGATTATAATCCAGACTTGGGATCCAGCAAGCCGATAACAGCTGGGTCTGGAACCCACTTGGATTACATCTATCGATAAGAGCTGGCCTTCAAGAGAGCACAATCCAAACTTGCCAAAATATATTTGTTTTCCGGCACCTGTAATATTCGCATCGTTGTAGCATAAGC

Full Affymetrix probeset data:

Annotations for 1625245_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720