FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625246_at:

>probe:Drosophila_2:1625246_at:504:375; Interrogation_Position=105; Antisense; GAAGAGGCGGTCACGCATCAATCGC
>probe:Drosophila_2:1625246_at:544:33; Interrogation_Position=121; Antisense; ATCAATCGCTGCCTGGACTTTATTA
>probe:Drosophila_2:1625246_at:254:343; Interrogation_Position=153; Antisense; GCTTCAGGAGGTGTCGCATCTGGAC
>probe:Drosophila_2:1625246_at:106:41; Interrogation_Position=170; Antisense; ATCTGGACGGCGAGACCATGGCCAA
>probe:Drosophila_2:1625246_at:171:569; Interrogation_Position=222; Antisense; GGCAGTTCACCACCTGAGCAAGAAA
>probe:Drosophila_2:1625246_at:105:341; Interrogation_Position=239; Antisense; GCAAGAAAAACTGTCCGGTGGCCAC
>probe:Drosophila_2:1625246_at:89:47; Interrogation_Position=282; Antisense; ATCCGGAGTATATCAGAGCCCAATT
>probe:Drosophila_2:1625246_at:714:433; Interrogation_Position=318; Antisense; GAGTGGCTTTCGAGAATGCGTCCTG
>probe:Drosophila_2:1625246_at:411:233; Interrogation_Position=332; Antisense; AATGCGTCCTGGAAGTGTCCCAATT
>probe:Drosophila_2:1625246_at:200:599; Interrogation_Position=347; Antisense; TGTCCCAATTTCTGCAACACAACGG
>probe:Drosophila_2:1625246_at:251:571; Interrogation_Position=370; Antisense; GGCTATCAGCCGAGTTTCGAATTTG
>probe:Drosophila_2:1625246_at:476:363; Interrogation_Position=400; Antisense; GAATTGGATCATCTTGTGGCCTCCA
>probe:Drosophila_2:1625246_at:683:203; Interrogation_Position=436; Antisense; AAGCCAAATCTCTGGAGGCCCTGGT
>probe:Drosophila_2:1625246_at:389:111; Interrogation_Position=51; Antisense; AGCAAAGTCACGATCTCATCAGTAT

Paste this into a BLAST search page for me
GAAGAGGCGGTCACGCATCAATCGCATCAATCGCTGCCTGGACTTTATTAGCTTCAGGAGGTGTCGCATCTGGACATCTGGACGGCGAGACCATGGCCAAGGCAGTTCACCACCTGAGCAAGAAAGCAAGAAAAACTGTCCGGTGGCCACATCCGGAGTATATCAGAGCCCAATTGAGTGGCTTTCGAGAATGCGTCCTGAATGCGTCCTGGAAGTGTCCCAATTTGTCCCAATTTCTGCAACACAACGGGGCTATCAGCCGAGTTTCGAATTTGGAATTGGATCATCTTGTGGCCTCCAAAGCCAAATCTCTGGAGGCCCTGGTAGCAAAGTCACGATCTCATCAGTAT

Full Affymetrix probeset data:

Annotations for 1625246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720