Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625247_at:

>probe:Drosophila_2:1625247_at:401:223; Interrogation_Position=105; Antisense; AAGGTACAGAGGTCCCTGTGCCGTC
>probe:Drosophila_2:1625247_at:276:397; Interrogation_Position=133; Antisense; GACAACGAGACATGCAGGCGGGTTT
>probe:Drosophila_2:1625247_at:358:199; Interrogation_Position=136; Antisense; AACGAGACATGCAGGCGGGTTTGCC
>probe:Drosophila_2:1625247_at:505:445; Interrogation_Position=15; Antisense; GATGCAAATCAAGTTCCTGTTCACC
>probe:Drosophila_2:1625247_at:147:137; Interrogation_Position=177; Antisense; ACGAGTGAGTGGTCACTGCAGTGCC
>probe:Drosophila_2:1625247_at:599:607; Interrogation_Position=182; Antisense; TGAGTGGTCACTGCAGTGCCAGGCT
>probe:Drosophila_2:1625247_at:574:537; Interrogation_Position=187; Antisense; GGTCACTGCAGTGCCAGGCTGCAAT
>probe:Drosophila_2:1625247_at:19:629; Interrogation_Position=198; Antisense; TGCCAGGCTGCAATGCTGGTGCGAA
>probe:Drosophila_2:1625247_at:395:163; Interrogation_Position=20; Antisense; AAATCAAGTTCCTGTTCACCTTCCT
>probe:Drosophila_2:1625247_at:612:719; Interrogation_Position=40; Antisense; TTCCTCGCTCTGCTGATGATGGTCA
>probe:Drosophila_2:1625247_at:556:631; Interrogation_Position=44; Antisense; TCGCTCTGCTGATGATGGTCATCCT
>probe:Drosophila_2:1625247_at:41:279; Interrogation_Position=52; Antisense; CTGATGATGGTCATCCTGGGCGCCA
>probe:Drosophila_2:1625247_at:108:283; Interrogation_Position=93; Antisense; CTGCCTTTCCGGAAGGTACAGAGGT
>probe:Drosophila_2:1625247_at:405:693; Interrogation_Position=98; Antisense; TTTCCGGAAGGTACAGAGGTCCCTG

Paste this into a BLAST search page for me
AAGGTACAGAGGTCCCTGTGCCGTCGACAACGAGACATGCAGGCGGGTTTAACGAGACATGCAGGCGGGTTTGCCGATGCAAATCAAGTTCCTGTTCACCACGAGTGAGTGGTCACTGCAGTGCCTGAGTGGTCACTGCAGTGCCAGGCTGGTCACTGCAGTGCCAGGCTGCAATTGCCAGGCTGCAATGCTGGTGCGAAAAATCAAGTTCCTGTTCACCTTCCTTTCCTCGCTCTGCTGATGATGGTCATCGCTCTGCTGATGATGGTCATCCTCTGATGATGGTCATCCTGGGCGCCACTGCCTTTCCGGAAGGTACAGAGGTTTTCCGGAAGGTACAGAGGTCCCTG

Full Affymetrix probeset data:

Annotations for 1625247_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime