FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625249_at:

>probe:Drosophila_2:1625249_at:701:189; Interrogation_Position=1356; Antisense; AACATCCAGGTCAAGTGCAAGCACA
>probe:Drosophila_2:1625249_at:599:359; Interrogation_Position=1372; Antisense; GCAAGCACAAGCTCACGGGTCTGAT
>probe:Drosophila_2:1625249_at:203:291; Interrogation_Position=1387; Antisense; CGGGTCTGATGCGACGTTCGATCAA
>probe:Drosophila_2:1625249_at:355:129; Interrogation_Position=1425; Antisense; ACCAGCCAGTTGGTGGGCACAACAA
>probe:Drosophila_2:1625249_at:336:165; Interrogation_Position=1467; Antisense; AAATCGAGTATCCAGCGGCAGCATT
>probe:Drosophila_2:1625249_at:162:27; Interrogation_Position=1510; Antisense; ATACTGATGCCTTGGAGCACTCGCA
>probe:Drosophila_2:1625249_at:617:331; Interrogation_Position=1550; Antisense; GCGGCCCACGGATCGTGTGTATATA
>probe:Drosophila_2:1625249_at:258:687; Interrogation_Position=1569; Antisense; TATATAATCAGTGCACTGCCCACGC
>probe:Drosophila_2:1625249_at:69:207; Interrogation_Position=1689; Antisense; AAGCGATTCCCTCTGGATGCGGACA
>probe:Drosophila_2:1625249_at:703:399; Interrogation_Position=1710; Antisense; GACAGTGCGGACACGGCAACGTTGA
>probe:Drosophila_2:1625249_at:503:25; Interrogation_Position=1734; Antisense; ATAGGTCGCAGTTCGAGCAGCTCGA
>probe:Drosophila_2:1625249_at:527:73; Interrogation_Position=1758; Antisense; AGGAACTCAATGGACGCCTCTACGC
>probe:Drosophila_2:1625249_at:120:469; Interrogation_Position=1801; Antisense; GTTGCCCGGAGAACTTGTAGTCGTA
>probe:Drosophila_2:1625249_at:8:405; Interrogation_Position=1841; Antisense; GACTATGTGATATTCTGCACCCCAA

Paste this into a BLAST search page for me
AACATCCAGGTCAAGTGCAAGCACAGCAAGCACAAGCTCACGGGTCTGATCGGGTCTGATGCGACGTTCGATCAAACCAGCCAGTTGGTGGGCACAACAAAAATCGAGTATCCAGCGGCAGCATTATACTGATGCCTTGGAGCACTCGCAGCGGCCCACGGATCGTGTGTATATATATATAATCAGTGCACTGCCCACGCAAGCGATTCCCTCTGGATGCGGACAGACAGTGCGGACACGGCAACGTTGAATAGGTCGCAGTTCGAGCAGCTCGAAGGAACTCAATGGACGCCTCTACGCGTTGCCCGGAGAACTTGTAGTCGTAGACTATGTGATATTCTGCACCCCAA

Full Affymetrix probeset data:

Annotations for 1625249_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720