Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625250_at:

>probe:Drosophila_2:1625250_at:366:715; Interrogation_Position=1037; Antisense; TTCTGCTGTTCGGAAACGTCCTGAT
>probe:Drosophila_2:1625250_at:462:587; Interrogation_Position=1077; Antisense; TGGAGCTGTCCTGGTGTTCGCCGCA
>probe:Drosophila_2:1625250_at:322:281; Interrogation_Position=1102; Antisense; CTCTTTGTGGACATGCTGTACGGCA
>probe:Drosophila_2:1625250_at:331:487; Interrogation_Position=1119; Antisense; GTACGGCAAGAAGGCGCCACTGGCT
>probe:Drosophila_2:1625250_at:305:181; Interrogation_Position=1151; Antisense; AAAAGCCGCCAGTCGAGGGAAAGCT
>probe:Drosophila_2:1625250_at:460:619; Interrogation_Position=1219; Antisense; TGCATAGCCCTATGTACTGTACATA
>probe:Drosophila_2:1625250_at:88:109; Interrogation_Position=1253; Antisense; AGAAGACAATGCTTCCGGCTCGAGC
>probe:Drosophila_2:1625250_at:694:635; Interrogation_Position=1272; Antisense; TCGAGCGGCTGCAGCGCCAAAGTTT
>probe:Drosophila_2:1625250_at:523:693; Interrogation_Position=1294; Antisense; TTTCCCCATTTCCTAGAACTGCTTA
>probe:Drosophila_2:1625250_at:184:11; Interrogation_Position=1353; Antisense; ATTCGATACTTGATCTGCAACCCAT
>probe:Drosophila_2:1625250_at:642:615; Interrogation_Position=1368; Antisense; TGCAACCCATAGACCGTCGTTTAAG
>probe:Drosophila_2:1625250_at:22:161; Interrogation_Position=1441; Antisense; AAGTTTACACCAGACCTGCGGGTCT
>probe:Drosophila_2:1625250_at:708:329; Interrogation_Position=1458; Antisense; GCGGGTCTCTAACATACAGGATCAT
>probe:Drosophila_2:1625250_at:487:169; Interrogation_Position=1574; Antisense; AAAGGCAACTTATTTTCTGGCTCAG

Paste this into a BLAST search page for me
TTCTGCTGTTCGGAAACGTCCTGATTGGAGCTGTCCTGGTGTTCGCCGCACTCTTTGTGGACATGCTGTACGGCAGTACGGCAAGAAGGCGCCACTGGCTAAAAGCCGCCAGTCGAGGGAAAGCTTGCATAGCCCTATGTACTGTACATAAGAAGACAATGCTTCCGGCTCGAGCTCGAGCGGCTGCAGCGCCAAAGTTTTTTCCCCATTTCCTAGAACTGCTTAATTCGATACTTGATCTGCAACCCATTGCAACCCATAGACCGTCGTTTAAGAAGTTTACACCAGACCTGCGGGTCTGCGGGTCTCTAACATACAGGATCATAAAGGCAACTTATTTTCTGGCTCAG

Full Affymetrix probeset data:

Annotations for 1625250_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime