Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625252_s_at:

>probe:Drosophila_2:1625252_s_at:490:255; Interrogation_Position=117; Antisense; CAAAATGGACATTCGCAGGGACAGC
>probe:Drosophila_2:1625252_s_at:89:151; Interrogation_Position=125; Antisense; ACATTCGCAGGGACAGCCGCCAAGA
>probe:Drosophila_2:1625252_s_at:287:559; Interrogation_Position=135; Antisense; GGACAGCCGCCAAGACCGCCAAATG
>probe:Drosophila_2:1625252_s_at:559:249; Interrogation_Position=161; Antisense; CAATGGAAACGGCAACCAGCAGAGT
>probe:Drosophila_2:1625252_s_at:679:177; Interrogation_Position=167; Antisense; AAACGGCAACCAGCAGAGTGGACAA
>probe:Drosophila_2:1625252_s_at:33:587; Interrogation_Position=185; Antisense; TGGACAAGGACAAAGCGGGCAGAAC
>probe:Drosophila_2:1625252_s_at:461:255; Interrogation_Position=195; Antisense; CAAAGCGGGCAGAACAACTAGAACT
>probe:Drosophila_2:1625252_s_at:111:193; Interrogation_Position=210; Antisense; AACTAGAACTGGGATATTTCTGGAG
>probe:Drosophila_2:1625252_s_at:639:93; Interrogation_Position=37; Antisense; AGTTCGCATTGTTCAGCATCTTCCT
>probe:Drosophila_2:1625252_s_at:590:5; Interrogation_Position=44; Antisense; ATTGTTCAGCATCTTCCTTCTAATT
>probe:Drosophila_2:1625252_s_at:642:37; Interrogation_Position=54; Antisense; ATCTTCCTTCTAATTCTGGCTGTGG
>probe:Drosophila_2:1625252_s_at:407:245; Interrogation_Position=65; Antisense; AATTCTGGCTGTGGGTTTGGCACAA
>probe:Drosophila_2:1625252_s_at:91:593; Interrogation_Position=76; Antisense; TGGGTTTGGCACAAATGCCGCTGCA
>probe:Drosophila_2:1625252_s_at:334:167; Interrogation_Position=88; Antisense; AAATGCCGCTGCAGGTGGCCGCCCA

Paste this into a BLAST search page for me
CAAAATGGACATTCGCAGGGACAGCACATTCGCAGGGACAGCCGCCAAGAGGACAGCCGCCAAGACCGCCAAATGCAATGGAAACGGCAACCAGCAGAGTAAACGGCAACCAGCAGAGTGGACAATGGACAAGGACAAAGCGGGCAGAACCAAAGCGGGCAGAACAACTAGAACTAACTAGAACTGGGATATTTCTGGAGAGTTCGCATTGTTCAGCATCTTCCTATTGTTCAGCATCTTCCTTCTAATTATCTTCCTTCTAATTCTGGCTGTGGAATTCTGGCTGTGGGTTTGGCACAATGGGTTTGGCACAAATGCCGCTGCAAAATGCCGCTGCAGGTGGCCGCCCA

Full Affymetrix probeset data:

Annotations for 1625252_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime