Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625253_at:

>probe:Drosophila_2:1625253_at:504:51; Interrogation_Position=2584; Antisense; ATGCGAGTCATGTGCTGAGTCCCAG
>probe:Drosophila_2:1625253_at:569:361; Interrogation_Position=2611; Antisense; GCAATATGATCACGGAGGCGGCCAT
>probe:Drosophila_2:1625253_at:237:657; Interrogation_Position=2654; Antisense; TAAGTCTCCTTACTGCACGAGGGAA
>probe:Drosophila_2:1625253_at:528:559; Interrogation_Position=2675; Antisense; GGAAAGTCGATTCCGCTGCATTGTG
>probe:Drosophila_2:1625253_at:202:725; Interrogation_Position=2695; Antisense; TTGTGCCGTATCCACCAAACAGTGA
>probe:Drosophila_2:1625253_at:566:691; Interrogation_Position=2738; Antisense; TTTGGGCGACATTATCTACGTCCAG
>probe:Drosophila_2:1625253_at:680:357; Interrogation_Position=2774; Antisense; GAACGGCTGGTATAAGGGCACCCAT
>probe:Drosophila_2:1625253_at:308:315; Interrogation_Position=2829; Antisense; GCCTCCTTTGTTGAACCGGATTGTT
>probe:Drosophila_2:1625253_at:155:79; Interrogation_Position=2913; Antisense; AGGATTCAATCGTCGGTCTATTCGG
>probe:Drosophila_2:1625253_at:377:525; Interrogation_Position=2936; Antisense; GGGCTTCCAAATACGCAATCTCATA
>probe:Drosophila_2:1625253_at:570:301; Interrogation_Position=2982; Antisense; CCGTTTTGTACTCTTCCAATCGAAT
>probe:Drosophila_2:1625253_at:506:261; Interrogation_Position=3010; Antisense; CAGCTCGCCGTTGTACTTTTTTATA
>probe:Drosophila_2:1625253_at:599:557; Interrogation_Position=3074; Antisense; GGAACAGTTACTTAAGCCTTAGCGA
>probe:Drosophila_2:1625253_at:206:241; Interrogation_Position=3114; Antisense; AATAATCTAACCGATCCTTGTGCCC

Paste this into a BLAST search page for me
ATGCGAGTCATGTGCTGAGTCCCAGGCAATATGATCACGGAGGCGGCCATTAAGTCTCCTTACTGCACGAGGGAAGGAAAGTCGATTCCGCTGCATTGTGTTGTGCCGTATCCACCAAACAGTGATTTGGGCGACATTATCTACGTCCAGGAACGGCTGGTATAAGGGCACCCATGCCTCCTTTGTTGAACCGGATTGTTAGGATTCAATCGTCGGTCTATTCGGGGGCTTCCAAATACGCAATCTCATACCGTTTTGTACTCTTCCAATCGAATCAGCTCGCCGTTGTACTTTTTTATAGGAACAGTTACTTAAGCCTTAGCGAAATAATCTAACCGATCCTTGTGCCC

Full Affymetrix probeset data:

Annotations for 1625253_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime