FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625258_at:

>probe:Drosophila_2:1625258_at:206:359; Interrogation_Position=444; Antisense; GCAAAACCAGACCAGGCGGCGCAAA
>probe:Drosophila_2:1625258_at:430:173; Interrogation_Position=466; Antisense; AAAGCGGCCAATCCCATGAGCAGAG
>probe:Drosophila_2:1625258_at:207:609; Interrogation_Position=507; Antisense; TGAGATCCGGCGACTGCAGCACCAT
>probe:Drosophila_2:1625258_at:78:207; Interrogation_Position=550; Antisense; AAGCTGCCGTTCTCGCGTCTAGTGC
>probe:Drosophila_2:1625258_at:537:429; Interrogation_Position=577; Antisense; GAGTTCATCGTGAAGTACAGCGACG
>probe:Drosophila_2:1625258_at:718:135; Interrogation_Position=602; Antisense; ACGAGCCGCTAAGGGTCACCGAAGG
>probe:Drosophila_2:1625258_at:369:227; Interrogation_Position=623; Antisense; AAGGCGCCCTATTGGCCATGCAGGA
>probe:Drosophila_2:1625258_at:411:53; Interrogation_Position=640; Antisense; ATGCAGGAGTCGTGCGAGATGTACT
>probe:Drosophila_2:1625258_at:330:427; Interrogation_Position=655; Antisense; GAGATGTACTTGACGCAGCGGCTCG
>probe:Drosophila_2:1625258_at:583:619; Interrogation_Position=692; Antisense; TGCTAACCAAGCATCGCAATCGCGT
>probe:Drosophila_2:1625258_at:124:45; Interrogation_Position=704; Antisense; ATCGCAATCGCGTCACACTGGAGGT
>probe:Drosophila_2:1625258_at:420:325; Interrogation_Position=731; Antisense; GCGACATGGCATTGATGGCCTACAT
>probe:Drosophila_2:1625258_at:167:523; Interrogation_Position=766; Antisense; GGTCGGCAATTTTAGTCCAAAAGAG
>probe:Drosophila_2:1625258_at:135:649; Interrogation_Position=999; Antisense; TAAGAATCGGGATGAACTTCACCAA

Paste this into a BLAST search page for me
GCAAAACCAGACCAGGCGGCGCAAAAAAGCGGCCAATCCCATGAGCAGAGTGAGATCCGGCGACTGCAGCACCATAAGCTGCCGTTCTCGCGTCTAGTGCGAGTTCATCGTGAAGTACAGCGACGACGAGCCGCTAAGGGTCACCGAAGGAAGGCGCCCTATTGGCCATGCAGGAATGCAGGAGTCGTGCGAGATGTACTGAGATGTACTTGACGCAGCGGCTCGTGCTAACCAAGCATCGCAATCGCGTATCGCAATCGCGTCACACTGGAGGTGCGACATGGCATTGATGGCCTACATGGTCGGCAATTTTAGTCCAAAAGAGTAAGAATCGGGATGAACTTCACCAA

Full Affymetrix probeset data:

Annotations for 1625258_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720