FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625260_at:

>probe:Drosophila_2:1625260_at:403:643; Interrogation_Position=1035; Antisense; TCTTTGCCGGATTCGTGGACATGCA
>probe:Drosophila_2:1625260_at:376:401; Interrogation_Position=1052; Antisense; GACATGCAGAAGACGTACGCCTCGT
>probe:Drosophila_2:1625260_at:568:421; Interrogation_Position=1082; Antisense; GAGCAATTCGCCAAGATTCGGAGCA
>probe:Drosophila_2:1625260_at:110:117; Interrogation_Position=1103; Antisense; AGCATATCGCATCAGCTGAGCAGAT
>probe:Drosophila_2:1625260_at:169:335; Interrogation_Position=1135; Antisense; GCTGCTGCACGAGAACATAGCCAGT
>probe:Drosophila_2:1625260_at:526:499; Interrogation_Position=1158; Antisense; GTCTGGAGGCGATCAATAACTTCCT
>probe:Drosophila_2:1625260_at:196:31; Interrogation_Position=1173; Antisense; ATAACTTCCTGGACGACGAGGACCG
>probe:Drosophila_2:1625260_at:247:399; Interrogation_Position=1291; Antisense; GTAGGATCCCCACACACTTATTGGT
>probe:Drosophila_2:1625260_at:83:535; Interrogation_Position=1313; Antisense; GGTCTCCAAAGATTTTCCTAGCTCA
>probe:Drosophila_2:1625260_at:266:665; Interrogation_Position=1365; Antisense; TACTCGTTAACGATGCCGCTTAATC
>probe:Drosophila_2:1625260_at:79:179; Interrogation_Position=904; Antisense; AAACTCGCAGCATTTGATCAACATA
>probe:Drosophila_2:1625260_at:119:455; Interrogation_Position=919; Antisense; GATCAACATATGTACCCGCATGCAA
>probe:Drosophila_2:1625260_at:430:151; Interrogation_Position=946; Antisense; ACATCTTAATCTGTGCGCCAGCTAT
>probe:Drosophila_2:1625260_at:630:365; Interrogation_Position=985; Antisense; GAATCACCTCGTGGAACGTACCAAG

Paste this into a BLAST search page for me
TCTTTGCCGGATTCGTGGACATGCAGACATGCAGAAGACGTACGCCTCGTGAGCAATTCGCCAAGATTCGGAGCAAGCATATCGCATCAGCTGAGCAGATGCTGCTGCACGAGAACATAGCCAGTGTCTGGAGGCGATCAATAACTTCCTATAACTTCCTGGACGACGAGGACCGGTAGGATCCCCACACACTTATTGGTGGTCTCCAAAGATTTTCCTAGCTCATACTCGTTAACGATGCCGCTTAATCAAACTCGCAGCATTTGATCAACATAGATCAACATATGTACCCGCATGCAAACATCTTAATCTGTGCGCCAGCTATGAATCACCTCGTGGAACGTACCAAG

Full Affymetrix probeset data:

Annotations for 1625260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720