Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625262_at:

>probe:Drosophila_2:1625262_at:623:619; Interrogation_Position=3525; Antisense; TGCTTATTGCTTACCTGTGCTGCAG
>probe:Drosophila_2:1625262_at:585:595; Interrogation_Position=3540; Antisense; TGTGCTGCAGTTAGTCGGCGAGTAA
>probe:Drosophila_2:1625262_at:625:297; Interrogation_Position=3606; Antisense; CGCAGCGCGCACTGAAATTGCTTGA
>probe:Drosophila_2:1625262_at:528:247; Interrogation_Position=3621; Antisense; AATTGCTTGAAGTTTTCCGCTCTGC
>probe:Drosophila_2:1625262_at:181:177; Interrogation_Position=3665; Antisense; AAACTTGGCTCAACTTGGCTTGGAT
>probe:Drosophila_2:1625262_at:240:661; Interrogation_Position=3705; Antisense; TAACTTGGCTCGAATCGTGTTGGCT
>probe:Drosophila_2:1625262_at:385:237; Interrogation_Position=3739; Antisense; AATCGGAGTTGTCTCAGCATCTCGG
>probe:Drosophila_2:1625262_at:706:345; Interrogation_Position=3755; Antisense; GCATCTCGGCGCTGGAAAATGTCAC
>probe:Drosophila_2:1625262_at:373:11; Interrogation_Position=3782; Antisense; ATTTTCCATTGGCAGGTTCCGGGCA
>probe:Drosophila_2:1625262_at:609:469; Interrogation_Position=3797; Antisense; GTTCCGGGCAGACAGTTTGTGTTAC
>probe:Drosophila_2:1625262_at:564:691; Interrogation_Position=3812; Antisense; TTTGTGTTACCATTCCCCAGATAGA
>probe:Drosophila_2:1625262_at:681:147; Interrogation_Position=3876; Antisense; ACTAGTTCGTATTGTGTGCGCTCCC
>probe:Drosophila_2:1625262_at:264:625; Interrogation_Position=3892; Antisense; TGCGCTCCCGCATTCTTATTGTAAT
>probe:Drosophila_2:1625262_at:420:675; Interrogation_Position=4039; Antisense; TATTTTGATTAAGCCCGAACGACGA

Paste this into a BLAST search page for me
TGCTTATTGCTTACCTGTGCTGCAGTGTGCTGCAGTTAGTCGGCGAGTAACGCAGCGCGCACTGAAATTGCTTGAAATTGCTTGAAGTTTTCCGCTCTGCAAACTTGGCTCAACTTGGCTTGGATTAACTTGGCTCGAATCGTGTTGGCTAATCGGAGTTGTCTCAGCATCTCGGGCATCTCGGCGCTGGAAAATGTCACATTTTCCATTGGCAGGTTCCGGGCAGTTCCGGGCAGACAGTTTGTGTTACTTTGTGTTACCATTCCCCAGATAGAACTAGTTCGTATTGTGTGCGCTCCCTGCGCTCCCGCATTCTTATTGTAATTATTTTGATTAAGCCCGAACGACGA

Full Affymetrix probeset data:

Annotations for 1625262_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime