Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625263_at:

>probe:Drosophila_2:1625263_at:407:227; Interrogation_Position=10112; Antisense; AAGGCTCTGAAGACCGTTATTCCGA
>probe:Drosophila_2:1625263_at:629:215; Interrogation_Position=10240; Antisense; AAGATTTCCGTGCTCGTTCAATCGG
>probe:Drosophila_2:1625263_at:605:507; Interrogation_Position=10249; Antisense; GTGCTCGTTCAATCGGCAACTAACA
>probe:Drosophila_2:1625263_at:700:37; Interrogation_Position=10280; Antisense; ATCTTTGTCGTATGGATCCTGCTTG
>probe:Drosophila_2:1625263_at:97:619; Interrogation_Position=10299; Antisense; TGCTTGGCATCCCTGGCTATAATAT
>probe:Drosophila_2:1625263_at:408:51; Interrogation_Position=9777; Antisense; ATGCGAACACGCTTTGAATCTTACT
>probe:Drosophila_2:1625263_at:2:367; Interrogation_Position=9792; Antisense; GAATCTTACTCGACTGAATGCGGAT
>probe:Drosophila_2:1625263_at:429:369; Interrogation_Position=9807; Antisense; GAATGCGGATATGATGTACCTTCAT
>probe:Drosophila_2:1625263_at:242:487; Interrogation_Position=9822; Antisense; GTACCTTCATCAAGACTCAGGACTT
>probe:Drosophila_2:1625263_at:479:653; Interrogation_Position=9897; Antisense; TAATCAACACCGACCTGTACCATTT
>probe:Drosophila_2:1625263_at:407:317; Interrogation_Position=9923; Antisense; GCCTGACTCCGAATGTTGGTGAATT
>probe:Drosophila_2:1625263_at:482:31; Interrogation_Position=9964; Antisense; ATAACTGGACCTTTATCTGCAGCAA
>probe:Drosophila_2:1625263_at:266:617; Interrogation_Position=9981; Antisense; TGCAGCAATTGTGGCAACGGCTCGG
>probe:Drosophila_2:1625263_at:418:351; Interrogation_Position=9994; Antisense; GCAACGGCTCGGTGTTTTATTCAAC

Paste this into a BLAST search page for me
AAGGCTCTGAAGACCGTTATTCCGAAAGATTTCCGTGCTCGTTCAATCGGGTGCTCGTTCAATCGGCAACTAACAATCTTTGTCGTATGGATCCTGCTTGTGCTTGGCATCCCTGGCTATAATATATGCGAACACGCTTTGAATCTTACTGAATCTTACTCGACTGAATGCGGATGAATGCGGATATGATGTACCTTCATGTACCTTCATCAAGACTCAGGACTTTAATCAACACCGACCTGTACCATTTGCCTGACTCCGAATGTTGGTGAATTATAACTGGACCTTTATCTGCAGCAATGCAGCAATTGTGGCAACGGCTCGGGCAACGGCTCGGTGTTTTATTCAAC

Full Affymetrix probeset data:

Annotations for 1625263_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime