FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625265_at:

>probe:Drosophila_2:1625265_at:8:525; Interrogation_Position=1011; Antisense; GGGCGGTCACTACCATTACGACACC
>probe:Drosophila_2:1625265_at:327:157; Interrogation_Position=1031; Antisense; ACACCACGCCGGATATCGTTGAGTA
>probe:Drosophila_2:1625265_at:712:637; Interrogation_Position=1046; Antisense; TCGTTGAGTACGAGGCCTACCTGAA
>probe:Drosophila_2:1625265_at:140:611; Interrogation_Position=1063; Antisense; TACCTGAACGTAGCCGAACGGGTGG
>probe:Drosophila_2:1625265_at:55:659; Interrogation_Position=1098; Antisense; TAAGCCCGTGGCCACTCACAAAGTG
>probe:Drosophila_2:1625265_at:678:517; Interrogation_Position=1120; Antisense; GTGGGACGCGACTAGATCTTATCTG
>probe:Drosophila_2:1625265_at:19:39; Interrogation_Position=1135; Antisense; ATCTTATCTGCCGTATCTAGTTGTA
>probe:Drosophila_2:1625265_at:119:677; Interrogation_Position=1152; Antisense; TAGTTGTAGCCGACTTTTCCATTGC
>probe:Drosophila_2:1625265_at:485:123; Interrogation_Position=719; Antisense; AGCGCACTGGCGAACAGAACTTCAT
>probe:Drosophila_2:1625265_at:673:355; Interrogation_Position=755; Antisense; GCAAGGGCCTGGAGAACCACTACGG
>probe:Drosophila_2:1625265_at:406:715; Interrogation_Position=809; Antisense; TTCTGATCAAGAAGGGCGCTGCCCA
>probe:Drosophila_2:1625265_at:44:129; Interrogation_Position=833; Antisense; ACCAGCACGTGATGCGGGACTTCAG
>probe:Drosophila_2:1625265_at:57:529; Interrogation_Position=848; Antisense; GGGACTTCAGCAAGACGCCCATCAA
>probe:Drosophila_2:1625265_at:19:199; Interrogation_Position=889; Antisense; AACGAGTGGCTCAAGTTCTACGAGA

Paste this into a BLAST search page for me
GGGCGGTCACTACCATTACGACACCACACCACGCCGGATATCGTTGAGTATCGTTGAGTACGAGGCCTACCTGAATACCTGAACGTAGCCGAACGGGTGGTAAGCCCGTGGCCACTCACAAAGTGGTGGGACGCGACTAGATCTTATCTGATCTTATCTGCCGTATCTAGTTGTATAGTTGTAGCCGACTTTTCCATTGCAGCGCACTGGCGAACAGAACTTCATGCAAGGGCCTGGAGAACCACTACGGTTCTGATCAAGAAGGGCGCTGCCCAACCAGCACGTGATGCGGGACTTCAGGGGACTTCAGCAAGACGCCCATCAAAACGAGTGGCTCAAGTTCTACGAGA

Full Affymetrix probeset data:

Annotations for 1625265_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720