FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625266_at:

>probe:Drosophila_2:1625266_at:687:571; Interrogation_Position=426; Antisense; GGCTACTACAATCCGCTAAATGTTA
>probe:Drosophila_2:1625266_at:175:573; Interrogation_Position=491; Antisense; GGCGGTGTACACCAAACAGGCCTAC
>probe:Drosophila_2:1625266_at:668:447; Interrogation_Position=519; Antisense; GATGCCTATCCGTCGAACTACAATG
>probe:Drosophila_2:1625266_at:162:579; Interrogation_Position=548; Antisense; GGCCATTGGACATTTCACGGTGCTC
>probe:Drosophila_2:1625266_at:54:141; Interrogation_Position=564; Antisense; ACGGTGCTCGTTGCCGATCGGAATA
>probe:Drosophila_2:1625266_at:542:631; Interrogation_Position=618; Antisense; TCCGTGTCCGGCCAATCGTACAAGG
>probe:Drosophila_2:1625266_at:298:721; Interrogation_Position=645; Antisense; TTCCTGCTGGCCTGTAACTATGCGG
>probe:Drosophila_2:1625266_at:531:683; Interrogation_Position=663; Antisense; TATGCGGCCACCAATGTTCTGGGCA
>probe:Drosophila_2:1625266_at:615:33; Interrogation_Position=687; Antisense; ATCAAGATGTACAGTTCCTGCTCCA
>probe:Drosophila_2:1625266_at:80:327; Interrogation_Position=714; Antisense; GCGGCCAGCAAGTGTACCACCGGTA
>probe:Drosophila_2:1625266_at:63:91; Interrogation_Position=748; Antisense; AGTACAAGTATCTGTGCAGCGCCAA
>probe:Drosophila_2:1625266_at:450:489; Interrogation_Position=779; Antisense; GTACAACGTAAACAACCTCTTCTAT
>probe:Drosophila_2:1625266_at:597:95; Interrogation_Position=817; Antisense; AGATGCTACGATCGGTTCAATTATT
>probe:Drosophila_2:1625266_at:310:353; Interrogation_Position=964; Antisense; GCAGCATATCTGTAACATTCCTATT

Paste this into a BLAST search page for me
GGCTACTACAATCCGCTAAATGTTAGGCGGTGTACACCAAACAGGCCTACGATGCCTATCCGTCGAACTACAATGGGCCATTGGACATTTCACGGTGCTCACGGTGCTCGTTGCCGATCGGAATATCCGTGTCCGGCCAATCGTACAAGGTTCCTGCTGGCCTGTAACTATGCGGTATGCGGCCACCAATGTTCTGGGCAATCAAGATGTACAGTTCCTGCTCCAGCGGCCAGCAAGTGTACCACCGGTAAGTACAAGTATCTGTGCAGCGCCAAGTACAACGTAAACAACCTCTTCTATAGATGCTACGATCGGTTCAATTATTGCAGCATATCTGTAACATTCCTATT

Full Affymetrix probeset data:

Annotations for 1625266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720