FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625268_at:

>probe:Drosophila_2:1625268_at:181:41; Interrogation_Position=1029; Antisense; ATCTGGTCGATTAGTGCCTCTGATC
>probe:Drosophila_2:1625268_at:86:531; Interrogation_Position=1056; Antisense; GGGTTCAATGTCACAAGTCGCCATG
>probe:Drosophila_2:1625268_at:496:155; Interrogation_Position=1126; Antisense; ACAGCAGTTCTCTTTTGTATAGCAA
>probe:Drosophila_2:1625268_at:112:591; Interrogation_Position=705; Antisense; TGGTTCGCAAGGCAGCCATCATCAC
>probe:Drosophila_2:1625268_at:550:417; Interrogation_Position=739; Antisense; GAGCTTCACTCACTTGGTCCAGAAT
>probe:Drosophila_2:1625268_at:526:661; Interrogation_Position=789; Antisense; TAACAAGCGGGATCTACGCCTACTG
>probe:Drosophila_2:1625268_at:543:61; Interrogation_Position=828; Antisense; ATGTCGGCTGGTTCTGGTGGTCCAT
>probe:Drosophila_2:1625268_at:111:41; Interrogation_Position=851; Antisense; ATCGGAACCCAGATCGTGCTATTGA
>probe:Drosophila_2:1625268_at:284:509; Interrogation_Position=866; Antisense; GTGCTATTGAATCCCATCTGCATAT
>probe:Drosophila_2:1625268_at:587:51; Interrogation_Position=889; Antisense; ATGCATTTACACACTGGTCAGCTGG
>probe:Drosophila_2:1625268_at:151:537; Interrogation_Position=904; Antisense; GGTCAGCTGGCTGTTCTTCCACGAT
>probe:Drosophila_2:1625268_at:151:261; Interrogation_Position=923; Antisense; CACGATCGCATCTACGTCGAGGAGT
>probe:Drosophila_2:1625268_at:598:651; Interrogation_Position=957; Antisense; TCAACTTCTTCCAGTCGGACTATGT
>probe:Drosophila_2:1625268_at:661:23; Interrogation_Position=987; Antisense; ATCAAAAGCGGGTGCCAACGGGCCT

Paste this into a BLAST search page for me
ATCTGGTCGATTAGTGCCTCTGATCGGGTTCAATGTCACAAGTCGCCATGACAGCAGTTCTCTTTTGTATAGCAATGGTTCGCAAGGCAGCCATCATCACGAGCTTCACTCACTTGGTCCAGAATTAACAAGCGGGATCTACGCCTACTGATGTCGGCTGGTTCTGGTGGTCCATATCGGAACCCAGATCGTGCTATTGAGTGCTATTGAATCCCATCTGCATATATGCATTTACACACTGGTCAGCTGGGGTCAGCTGGCTGTTCTTCCACGATCACGATCGCATCTACGTCGAGGAGTTCAACTTCTTCCAGTCGGACTATGTATCAAAAGCGGGTGCCAACGGGCCT

Full Affymetrix probeset data:

Annotations for 1625268_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720