Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625269_at:

>probe:Drosophila_2:1625269_at:404:139; Interrogation_Position=2135; Antisense; ACGTGATCATCCATTGCGCTCTGAA
>probe:Drosophila_2:1625269_at:332:609; Interrogation_Position=2160; Antisense; TGAGAAGCGTGCTAACCCCTATTAC
>probe:Drosophila_2:1625269_at:86:133; Interrogation_Position=2183; Antisense; ACGCTCATTTGGCACTTAAGTTCTG
>probe:Drosophila_2:1625269_at:591:339; Interrogation_Position=2233; Antisense; GCTTTCCAGTTTGCCAGTTGGGACA
>probe:Drosophila_2:1625269_at:158:183; Interrogation_Position=2273; Antisense; AAAAGCTTTCCAAGCCGCAGATTCG
>probe:Drosophila_2:1625269_at:568:253; Interrogation_Position=2298; Antisense; CAACCTGGCTAGTTTTCTGCAGCAA
>probe:Drosophila_2:1625269_at:101:219; Interrogation_Position=2321; Antisense; AAGTAATCCTAGCTGCTGGTCTGCA
>probe:Drosophila_2:1625269_at:383:591; Interrogation_Position=2337; Antisense; TGGTCTGCAGCTGTCAGTGCTCAAA
>probe:Drosophila_2:1625269_at:384:87; Interrogation_Position=2364; Antisense; AGTCGACTTTATGCAGCTGGACAAG
>probe:Drosophila_2:1625269_at:19:591; Interrogation_Position=2417; Antisense; TGGTCAGGCTGCTTTTGGCTAACGA
>probe:Drosophila_2:1625269_at:726:173; Interrogation_Position=2507; Antisense; AAAGCGTAAGGCTCTTCCTGCAGCA
>probe:Drosophila_2:1625269_at:174:557; Interrogation_Position=2574; Antisense; GGACGAGGATCGACAGCTTCTGCAG
>probe:Drosophila_2:1625269_at:469:617; Interrogation_Position=2594; Antisense; TGCAGCAGCGCGTTGATCACATAGA
>probe:Drosophila_2:1625269_at:533:189; Interrogation_Position=2621; Antisense; AACTTTTAGCCTATGTGGACCTGTA

Paste this into a BLAST search page for me
ACGTGATCATCCATTGCGCTCTGAATGAGAAGCGTGCTAACCCCTATTACACGCTCATTTGGCACTTAAGTTCTGGCTTTCCAGTTTGCCAGTTGGGACAAAAAGCTTTCCAAGCCGCAGATTCGCAACCTGGCTAGTTTTCTGCAGCAAAAGTAATCCTAGCTGCTGGTCTGCATGGTCTGCAGCTGTCAGTGCTCAAAAGTCGACTTTATGCAGCTGGACAAGTGGTCAGGCTGCTTTTGGCTAACGAAAAGCGTAAGGCTCTTCCTGCAGCAGGACGAGGATCGACAGCTTCTGCAGTGCAGCAGCGCGTTGATCACATAGAAACTTTTAGCCTATGTGGACCTGTA

Full Affymetrix probeset data:

Annotations for 1625269_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime