FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625270_at:

>probe:Drosophila_2:1625270_at:353:593; Interrogation_Position=1392; Antisense; TGGGCATCTTCTCATTTCTTTTCAA
>probe:Drosophila_2:1625270_at:586:643; Interrogation_Position=1408; Antisense; TCTTTTCAAGTCGACTACCTGCGGA
>probe:Drosophila_2:1625270_at:468:405; Interrogation_Position=1431; Antisense; GACTGCGTCACACGTTTGGTTTCGA
>probe:Drosophila_2:1625270_at:507:481; Interrogation_Position=1444; Antisense; GTTTGGTTTCGACAATGCTCTCTTC
>probe:Drosophila_2:1625270_at:86:129; Interrogation_Position=1520; Antisense; ACCACGGTGGCCTGTTATCTAATGT
>probe:Drosophila_2:1625270_at:281:595; Interrogation_Position=1542; Antisense; TGTGGAAGTCCATGCATCTGCTCTA
>probe:Drosophila_2:1625270_at:22:295; Interrogation_Position=1614; Antisense; CGATGCTCATGTACGGATTCTTCAC
>probe:Drosophila_2:1625270_at:33:341; Interrogation_Position=1689; Antisense; GCTACTACAAGTTCCTCATGGGCAT
>probe:Drosophila_2:1625270_at:421:647; Interrogation_Position=1704; Antisense; TCATGGGCATCTCCGGAAATCGCAT
>probe:Drosophila_2:1625270_at:449:395; Interrogation_Position=1719; Antisense; GAAATCGCATCAGTCGCTTTAATGT
>probe:Drosophila_2:1625270_at:266:415; Interrogation_Position=1771; Antisense; GAGCCAGGACCAGATCAACTATGTG
>probe:Drosophila_2:1625270_at:342:391; Interrogation_Position=1801; Antisense; GAAACTGGGCATCGACATGACCTCA
>probe:Drosophila_2:1625270_at:49:709; Interrogation_Position=1837; Antisense; TTACGCCCTGACTGTCTAGATGGGT
>probe:Drosophila_2:1625270_at:243:31; Interrogation_Position=1869; Antisense; ATAACTTCGCATACCTACTGTACAG

Paste this into a BLAST search page for me
TGGGCATCTTCTCATTTCTTTTCAATCTTTTCAAGTCGACTACCTGCGGAGACTGCGTCACACGTTTGGTTTCGAGTTTGGTTTCGACAATGCTCTCTTCACCACGGTGGCCTGTTATCTAATGTTGTGGAAGTCCATGCATCTGCTCTACGATGCTCATGTACGGATTCTTCACGCTACTACAAGTTCCTCATGGGCATTCATGGGCATCTCCGGAAATCGCATGAAATCGCATCAGTCGCTTTAATGTGAGCCAGGACCAGATCAACTATGTGGAAACTGGGCATCGACATGACCTCATTACGCCCTGACTGTCTAGATGGGTATAACTTCGCATACCTACTGTACAG

Full Affymetrix probeset data:

Annotations for 1625270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720