Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625271_at:

>probe:Drosophila_2:1625271_at:646:413; Interrogation_Position=1281; Antisense; GACCATTATCATTGGCGGCACGGGC
>probe:Drosophila_2:1625271_at:338:569; Interrogation_Position=1303; Antisense; GGCTTCCACAACAACGCGGTAACAG
>probe:Drosophila_2:1625271_at:71:493; Interrogation_Position=1321; Antisense; GTAACAGTGAATCCCCAAGACCTGG
>probe:Drosophila_2:1625271_at:422:637; Interrogation_Position=1357; Antisense; TCGGGCAGCGTCTTTGGCCTGATGA
>probe:Drosophila_2:1625271_at:287:445; Interrogation_Position=1377; Antisense; GATGAACACAGTGGGCGCGATTCCT
>probe:Drosophila_2:1625271_at:18:463; Interrogation_Position=1395; Antisense; GATTCCTGGCTTTCTCGGAGTATAC
>probe:Drosophila_2:1625271_at:624:673; Interrogation_Position=1415; Antisense; TATACTTGGCCGGACACATTCTGGA
>probe:Drosophila_2:1625271_at:728:587; Interrogation_Position=1436; Antisense; TGGAGCTCACACAAAGCTGGCCGAT
>probe:Drosophila_2:1625271_at:384:303; Interrogation_Position=1472; Antisense; CCGCTGCTGGCATCAATTTGGTTGG
>probe:Drosophila_2:1625271_at:565:685; Interrogation_Position=1509; Antisense; TATAGTCTTTGGTTCGGCGGAAGCC
>probe:Drosophila_2:1625271_at:687:635; Interrogation_Position=1522; Antisense; TCGGCGGAAGCCATCGTTTAACATT
>probe:Drosophila_2:1625271_at:111:479; Interrogation_Position=1537; Antisense; GTTTAACATTCTCTTGCACACTTTC
>probe:Drosophila_2:1625271_at:455:211; Interrogation_Position=1727; Antisense; AAGGACCCTGTGAGTTTTAGCCAAT
>probe:Drosophila_2:1625271_at:495:395; Interrogation_Position=1808; Antisense; GAAATCTTACTGCTCCTAGCGTGAT

Paste this into a BLAST search page for me
GACCATTATCATTGGCGGCACGGGCGGCTTCCACAACAACGCGGTAACAGGTAACAGTGAATCCCCAAGACCTGGTCGGGCAGCGTCTTTGGCCTGATGAGATGAACACAGTGGGCGCGATTCCTGATTCCTGGCTTTCTCGGAGTATACTATACTTGGCCGGACACATTCTGGATGGAGCTCACACAAAGCTGGCCGATCCGCTGCTGGCATCAATTTGGTTGGTATAGTCTTTGGTTCGGCGGAAGCCTCGGCGGAAGCCATCGTTTAACATTGTTTAACATTCTCTTGCACACTTTCAAGGACCCTGTGAGTTTTAGCCAATGAAATCTTACTGCTCCTAGCGTGAT

Full Affymetrix probeset data:

Annotations for 1625271_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime