FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625272_at:

>probe:Drosophila_2:1625272_at:651:729; Interrogation_Position=1133; Antisense; TTGGCATCCTGGGACTCGGCATATC
>probe:Drosophila_2:1625272_at:448:201; Interrogation_Position=1183; Antisense; AACCGATTCGAGAGTTCGCGCAGCA
>probe:Drosophila_2:1625272_at:180:93; Interrogation_Position=1211; Antisense; AGTTGACCTTCACCGTACAGGAGTA
>probe:Drosophila_2:1625272_at:107:497; Interrogation_Position=1241; Antisense; GTCATAAATCTCTCATAACCCAATA
>probe:Drosophila_2:1625272_at:619:199; Interrogation_Position=1257; Antisense; AACCCAATAGATCTCGGGCAGCCAT
>probe:Drosophila_2:1625272_at:9:527; Interrogation_Position=1272; Antisense; GGGCAGCCATGTTCATCCAGATCAC
>probe:Drosophila_2:1625272_at:117:89; Interrogation_Position=1290; Antisense; AGATCACCTACGTGGCTTTCAAGCC
>probe:Drosophila_2:1625272_at:388:473; Interrogation_Position=1324; Antisense; GTTCACCTTGGCCATCGAGTTCTTT
>probe:Drosophila_2:1625272_at:470:429; Interrogation_Position=1340; Antisense; GAGTTCTTTCTCATTCACTTGCTAT
>probe:Drosophila_2:1625272_at:645:341; Interrogation_Position=1360; Antisense; GCTATTCGTGTTGATCGTGTTGTAC
>probe:Drosophila_2:1625272_at:345:669; Interrogation_Position=1382; Antisense; TACGTGTATGTGCTATGGTACTACT
>probe:Drosophila_2:1625272_at:296:387; Interrogation_Position=1491; Antisense; GAACAAGTGTTTAACTGCCTGTCAT
>probe:Drosophila_2:1625272_at:685:143; Interrogation_Position=1504; Antisense; ACTGCCTGTCATGTTCTTCAAAATT
>probe:Drosophila_2:1625272_at:679:171; Interrogation_Position=1664; Antisense; AAAGCATGCTTTTCGGGTACATCTC

Paste this into a BLAST search page for me
TTGGCATCCTGGGACTCGGCATATCAACCGATTCGAGAGTTCGCGCAGCAAGTTGACCTTCACCGTACAGGAGTAGTCATAAATCTCTCATAACCCAATAAACCCAATAGATCTCGGGCAGCCATGGGCAGCCATGTTCATCCAGATCACAGATCACCTACGTGGCTTTCAAGCCGTTCACCTTGGCCATCGAGTTCTTTGAGTTCTTTCTCATTCACTTGCTATGCTATTCGTGTTGATCGTGTTGTACTACGTGTATGTGCTATGGTACTACTGAACAAGTGTTTAACTGCCTGTCATACTGCCTGTCATGTTCTTCAAAATTAAAGCATGCTTTTCGGGTACATCTC

Full Affymetrix probeset data:

Annotations for 1625272_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720