FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625273_at:

>probe:Drosophila_2:1625273_at:338:451; Interrogation_Position=1015; Antisense; GATCGTCTGGATCATCTGGACAACG
>probe:Drosophila_2:1625273_at:238:355; Interrogation_Position=1050; Antisense; GCACTCCCAACTTCAGCTAAAATTT
>probe:Drosophila_2:1625273_at:340:241; Interrogation_Position=1094; Antisense; AATTAGACGAGGAGGACTGCACCCC
>probe:Drosophila_2:1625273_at:626:691; Interrogation_Position=1134; Antisense; TTTGGACTACATCTCTCTATGGCAG
>probe:Drosophila_2:1625273_at:56:421; Interrogation_Position=1159; Antisense; GAGCAGTGACTTAATCCCCAAAATT
>probe:Drosophila_2:1625273_at:615:131; Interrogation_Position=1191; Antisense; ACGCCCTATTTTCTTCTAGTCAATG
>probe:Drosophila_2:1625273_at:367:379; Interrogation_Position=1318; Antisense; GAACCACGAGACCAGTTTCAAATTT
>probe:Drosophila_2:1625273_at:628:123; Interrogation_Position=837; Antisense; AGCGCTCTCATTAAATACCAACTTG
>probe:Drosophila_2:1625273_at:286:1; Interrogation_Position=851; Antisense; ATACCAACTTGGTGGGCACATCCGT
>probe:Drosophila_2:1625273_at:586:525; Interrogation_Position=864; Antisense; GGGCACATCCGTACCAGGTGGAGAT
>probe:Drosophila_2:1625273_at:47:447; Interrogation_Position=886; Antisense; GATGCAGGATGCGTATCCACCAGCA
>probe:Drosophila_2:1625273_at:36:191; Interrogation_Position=936; Antisense; AACATCATCATTCAACTCCAGCATG
>probe:Drosophila_2:1625273_at:487:191; Interrogation_Position=949; Antisense; AACTCCAGCATGTCCTTTGATTCAG
>probe:Drosophila_2:1625273_at:19:503; Interrogation_Position=960; Antisense; GTCCTTTGATTCAGGCACCTACGAA

Paste this into a BLAST search page for me
GATCGTCTGGATCATCTGGACAACGGCACTCCCAACTTCAGCTAAAATTTAATTAGACGAGGAGGACTGCACCCCTTTGGACTACATCTCTCTATGGCAGGAGCAGTGACTTAATCCCCAAAATTACGCCCTATTTTCTTCTAGTCAATGGAACCACGAGACCAGTTTCAAATTTAGCGCTCTCATTAAATACCAACTTGATACCAACTTGGTGGGCACATCCGTGGGCACATCCGTACCAGGTGGAGATGATGCAGGATGCGTATCCACCAGCAAACATCATCATTCAACTCCAGCATGAACTCCAGCATGTCCTTTGATTCAGGTCCTTTGATTCAGGCACCTACGAA

Full Affymetrix probeset data:

Annotations for 1625273_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720