FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625275_at:

>probe:Drosophila_2:1625275_at:61:367; Interrogation_Position=1004; Antisense; GAATCTTCTGCATGGTCACAGTCCG
>probe:Drosophila_2:1625275_at:73:535; Interrogation_Position=1028; Antisense; GGTGCTGCCCGCTTTCAAGAAAACC
>probe:Drosophila_2:1625275_at:108:351; Interrogation_Position=1060; Antisense; GCAGCAAGACCTATGTGGACAGCTA
>probe:Drosophila_2:1625275_at:438:201; Interrogation_Position=1091; Antisense; AACCCATCTCTTCAGCGAGTTTGAC
>probe:Drosophila_2:1625275_at:324:255; Interrogation_Position=1127; Antisense; CAAACTGGACCTGCAGCAAACGGGA
>probe:Drosophila_2:1625275_at:325:221; Interrogation_Position=1244; Antisense; AAGTGGTTCGCATCCATTATCTAAC
>probe:Drosophila_2:1625275_at:682:271; Interrogation_Position=1280; Antisense; CATTTCAAAACCTTTGCCATACGCC
>probe:Drosophila_2:1625275_at:687:477; Interrogation_Position=1313; Antisense; GTTTAGTGCACATCCATTCCCATTC
>probe:Drosophila_2:1625275_at:396:601; Interrogation_Position=1341; Antisense; TGTTTGCAAGCCATTCGTATCCAGC
>probe:Drosophila_2:1625275_at:653:683; Interrogation_Position=1358; Antisense; TATCCAGCCCATGCACCGTGAAAAA
>probe:Drosophila_2:1625275_at:132:53; Interrogation_Position=1487; Antisense; ATGCAACCGTTTTGTTTTCTATTGA
>probe:Drosophila_2:1625275_at:228:323; Interrogation_Position=933; Antisense; GCGCCCACGGTTGGCAAGAGTCAGT
>probe:Drosophila_2:1625275_at:140:215; Interrogation_Position=948; Antisense; AAGAGTCAGTCGCATCCATTGGCCG
>probe:Drosophila_2:1625275_at:40:581; Interrogation_Position=977; Antisense; GGCCAAGGCGCAGTCTTATCAGAAT

Paste this into a BLAST search page for me
GAATCTTCTGCATGGTCACAGTCCGGGTGCTGCCCGCTTTCAAGAAAACCGCAGCAAGACCTATGTGGACAGCTAAACCCATCTCTTCAGCGAGTTTGACCAAACTGGACCTGCAGCAAACGGGAAAGTGGTTCGCATCCATTATCTAACCATTTCAAAACCTTTGCCATACGCCGTTTAGTGCACATCCATTCCCATTCTGTTTGCAAGCCATTCGTATCCAGCTATCCAGCCCATGCACCGTGAAAAAATGCAACCGTTTTGTTTTCTATTGAGCGCCCACGGTTGGCAAGAGTCAGTAAGAGTCAGTCGCATCCATTGGCCGGGCCAAGGCGCAGTCTTATCAGAAT

Full Affymetrix probeset data:

Annotations for 1625275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720