Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625276_a_at:

>probe:Drosophila_2:1625276_a_at:51:611; Interrogation_Position=532; Antisense; TGACCACGCCCATCAAGAGGCAGTA
>probe:Drosophila_2:1625276_a_at:252:569; Interrogation_Position=550; Antisense; GGCAGTACGCCTCCTTGATTCTGTA
>probe:Drosophila_2:1625276_a_at:63:533; Interrogation_Position=596; Antisense; GGTGGCACACGCCTCCAAATTGGAG
>probe:Drosophila_2:1625276_a_at:550:415; Interrogation_Position=627; Antisense; GAGCGCCGTGCACCGGAGATCATAA
>probe:Drosophila_2:1625276_a_at:406:251; Interrogation_Position=668; Antisense; CAAGGAGAACTTTTACCCAGCCGAG
>probe:Drosophila_2:1625276_a_at:95:125; Interrogation_Position=686; Antisense; AGCCGAGGCGTACCACCAGAAGTAT
>probe:Drosophila_2:1625276_a_at:132:541; Interrogation_Position=712; Antisense; GGTTGCAGGGCCACAAGGATCTCGC
>probe:Drosophila_2:1625276_a_at:9:619; Interrogation_Position=766; Antisense; TGCAGACCAGCTATGTGGCCACCAA
>probe:Drosophila_2:1625276_a_at:677:193; Interrogation_Position=790; Antisense; AACTGAATGGCTACCTGGCCGGAGT
>probe:Drosophila_2:1625276_a_at:132:351; Interrogation_Position=875; Antisense; GCAGTACTGCTACTACCACGTGGAG
>probe:Drosophila_2:1625276_a_at:68:109; Interrogation_Position=901; Antisense; AGAACGAGGGCCAGGGTCTCTACTG
>probe:Drosophila_2:1625276_a_at:32:499; Interrogation_Position=916; Antisense; GTCTCTACTGCTGACATGGCCGAAT
>probe:Drosophila_2:1625276_a_at:357:69; Interrogation_Position=931; Antisense; ATGGCCGAATCTGCATAGACGTTAA
>probe:Drosophila_2:1625276_a_at:31:475; Interrogation_Position=951; Antisense; GTTAAGCGTAGATCGTACACCTAGG

Paste this into a BLAST search page for me
TGACCACGCCCATCAAGAGGCAGTAGGCAGTACGCCTCCTTGATTCTGTAGGTGGCACACGCCTCCAAATTGGAGGAGCGCCGTGCACCGGAGATCATAACAAGGAGAACTTTTACCCAGCCGAGAGCCGAGGCGTACCACCAGAAGTATGGTTGCAGGGCCACAAGGATCTCGCTGCAGACCAGCTATGTGGCCACCAAAACTGAATGGCTACCTGGCCGGAGTGCAGTACTGCTACTACCACGTGGAGAGAACGAGGGCCAGGGTCTCTACTGGTCTCTACTGCTGACATGGCCGAATATGGCCGAATCTGCATAGACGTTAAGTTAAGCGTAGATCGTACACCTAGG

Full Affymetrix probeset data:

Annotations for 1625276_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime