Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625277_at:

>probe:Drosophila_2:1625277_at:131:123; Interrogation_Position=395; Antisense; AGCCGGATTTGAGTGTTCCCTCCAA
>probe:Drosophila_2:1625277_at:163:461; Interrogation_Position=455; Antisense; GATTCGACCGAGGACACTTGGCAGC
>probe:Drosophila_2:1625277_at:454:695; Interrogation_Position=525; Antisense; TTTCCTAACGAATATTGCCCCACAA
>probe:Drosophila_2:1625277_at:175:39; Interrogation_Position=596; Antisense; ATGTTCGAAATCTGGTCCACCGATT
>probe:Drosophila_2:1625277_at:121:257; Interrogation_Position=613; Antisense; CACCGATTTGGATCCGTTTTCGTGT
>probe:Drosophila_2:1625277_at:515:477; Interrogation_Position=628; Antisense; GTTTTCGTGTGTACTGGTCCACTAT
>probe:Drosophila_2:1625277_at:462:241; Interrogation_Position=712; Antisense; AATATGGTTGCAGTTCCGACGCACT
>probe:Drosophila_2:1625277_at:40:721; Interrogation_Position=725; Antisense; TTCCGACGCACTTCTTCAAGGTGAT
>probe:Drosophila_2:1625277_at:572:561; Interrogation_Position=756; Antisense; GGAATCAAAACTGCACCTGGGTAAA
>probe:Drosophila_2:1625277_at:636:679; Interrogation_Position=786; Antisense; TATGGAGGGCTATGTCCTGCCCAAT
>probe:Drosophila_2:1625277_at:112:99; Interrogation_Position=822; Antisense; AGATGGTCTGCCACTACGATCGTTT
>probe:Drosophila_2:1625277_at:423:47; Interrogation_Position=856; Antisense; ATCCGGGAGATTGAGCACTACGCAG
>probe:Drosophila_2:1625277_at:660:671; Interrogation_Position=874; Antisense; TACGCAGGTCTCAAGTTCTTCGATG
>probe:Drosophila_2:1625277_at:699:371; Interrogation_Position=905; Antisense; GAAGGAGTGCCCTATTCGGCAGCAA

Paste this into a BLAST search page for me
AGCCGGATTTGAGTGTTCCCTCCAAGATTCGACCGAGGACACTTGGCAGCTTTCCTAACGAATATTGCCCCACAAATGTTCGAAATCTGGTCCACCGATTCACCGATTTGGATCCGTTTTCGTGTGTTTTCGTGTGTACTGGTCCACTATAATATGGTTGCAGTTCCGACGCACTTTCCGACGCACTTCTTCAAGGTGATGGAATCAAAACTGCACCTGGGTAAATATGGAGGGCTATGTCCTGCCCAATAGATGGTCTGCCACTACGATCGTTTATCCGGGAGATTGAGCACTACGCAGTACGCAGGTCTCAAGTTCTTCGATGGAAGGAGTGCCCTATTCGGCAGCAA

Full Affymetrix probeset data:

Annotations for 1625277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime