FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625280_at:

>probe:Drosophila_2:1625280_at:650:489; Interrogation_Position=3447; Antisense; GTACAAGTGCATAAACCTTAACGGT
>probe:Drosophila_2:1625280_at:382:201; Interrogation_Position=3460; Antisense; AACCTTAACGGTGAGCAGAGAGATA
>probe:Drosophila_2:1625280_at:83:455; Interrogation_Position=3487; Antisense; GATACGGATTGTTTTACCTAGTCTA
>probe:Drosophila_2:1625280_at:24:499; Interrogation_Position=3507; Antisense; GTCTAATAACTGAGATACAGCGCAT
>probe:Drosophila_2:1625280_at:721:155; Interrogation_Position=3523; Antisense; ACAGCGCATTGTTAAAGTTTACCGA
>probe:Drosophila_2:1625280_at:289:217; Interrogation_Position=3537; Antisense; AAGTTTACCGATAATGTGCGAGAGG
>probe:Drosophila_2:1625280_at:192:153; Interrogation_Position=3635; Antisense; ACATGAAGAGGTGACGGCGGAAACT
>probe:Drosophila_2:1625280_at:50:3; Interrogation_Position=3648; Antisense; ACGGCGGAAACTGTGGAATAACCAT
>probe:Drosophila_2:1625280_at:580:223; Interrogation_Position=3750; Antisense; AAGGAGTATCTTATGTGGCCGTTAA
>probe:Drosophila_2:1625280_at:168:521; Interrogation_Position=3764; Antisense; GTGGCCGTTAAGTTGATTTTTGATG
>probe:Drosophila_2:1625280_at:429:373; Interrogation_Position=3801; Antisense; GAAGTAGCACCAATAGATGCACCAT
>probe:Drosophila_2:1625280_at:562:445; Interrogation_Position=3816; Antisense; GATGCACCATACCACTCAAAATTAT
>probe:Drosophila_2:1625280_at:218:683; Interrogation_Position=3918; Antisense; TTTGTCTTTTGGTGCGGTTTTGTCA
>probe:Drosophila_2:1625280_at:182:509; Interrogation_Position=3929; Antisense; GTGCGGTTTTGTCATTTCCATGTAA

Paste this into a BLAST search page for me
GTACAAGTGCATAAACCTTAACGGTAACCTTAACGGTGAGCAGAGAGATAGATACGGATTGTTTTACCTAGTCTAGTCTAATAACTGAGATACAGCGCATACAGCGCATTGTTAAAGTTTACCGAAAGTTTACCGATAATGTGCGAGAGGACATGAAGAGGTGACGGCGGAAACTACGGCGGAAACTGTGGAATAACCATAAGGAGTATCTTATGTGGCCGTTAAGTGGCCGTTAAGTTGATTTTTGATGGAAGTAGCACCAATAGATGCACCATGATGCACCATACCACTCAAAATTATTTTGTCTTTTGGTGCGGTTTTGTCAGTGCGGTTTTGTCATTTCCATGTAA

Full Affymetrix probeset data:

Annotations for 1625280_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720