Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625281_at:

>probe:Drosophila_2:1625281_at:232:223; Interrogation_Position=2873; Antisense; AAGGGTGACGCACTCAAGAGCCTCA
>probe:Drosophila_2:1625281_at:615:417; Interrogation_Position=2911; Antisense; GAGCGTGTTCCGGTTGAATCGCAAG
>probe:Drosophila_2:1625281_at:596:119; Interrogation_Position=2937; Antisense; AGCTGATCTCGTCGGAGTTCGCTGT
>probe:Drosophila_2:1625281_at:635:93; Interrogation_Position=2952; Antisense; AGTTCGCTGTGCTTGTGGCTCTGGA
>probe:Drosophila_2:1625281_at:268:695; Interrogation_Position=2978; Antisense; TTTAGCCTGCATGTAAACCGGCACG
>probe:Drosophila_2:1625281_at:383:121; Interrogation_Position=3021; Antisense; AGCGGCTGCTCTACGAGTCCTAGGA
>probe:Drosophila_2:1625281_at:650:429; Interrogation_Position=3035; Antisense; GAGTCCTAGGACTGGCCCAAGCGCT
>probe:Drosophila_2:1625281_at:483:205; Interrogation_Position=3053; Antisense; AAGCGCTGCGCCGAGAAGAGTTTCC
>probe:Drosophila_2:1625281_at:650:353; Interrogation_Position=3083; Antisense; GCAGCGCAGGCGGTACAGCAATTGT
>probe:Drosophila_2:1625281_at:493:263; Interrogation_Position=3098; Antisense; CAGCAATTGTGTCGCAAGGGCAGTC
>probe:Drosophila_2:1625281_at:328:349; Interrogation_Position=3117; Antisense; GCAGTCGCAAGTAGGCGTTCGTACT
>probe:Drosophila_2:1625281_at:559:485; Interrogation_Position=3127; Antisense; GTAGGCGTTCGTACTTATAGCATAC
>probe:Drosophila_2:1625281_at:106:681; Interrogation_Position=3142; Antisense; TATAGCATACTTTCGGGTGTTGGGT
>probe:Drosophila_2:1625281_at:341:5; Interrogation_Position=3180; Antisense; ATTGATAATATTCACCACCCTCATG

Paste this into a BLAST search page for me
AAGGGTGACGCACTCAAGAGCCTCAGAGCGTGTTCCGGTTGAATCGCAAGAGCTGATCTCGTCGGAGTTCGCTGTAGTTCGCTGTGCTTGTGGCTCTGGATTTAGCCTGCATGTAAACCGGCACGAGCGGCTGCTCTACGAGTCCTAGGAGAGTCCTAGGACTGGCCCAAGCGCTAAGCGCTGCGCCGAGAAGAGTTTCCGCAGCGCAGGCGGTACAGCAATTGTCAGCAATTGTGTCGCAAGGGCAGTCGCAGTCGCAAGTAGGCGTTCGTACTGTAGGCGTTCGTACTTATAGCATACTATAGCATACTTTCGGGTGTTGGGTATTGATAATATTCACCACCCTCATG

Full Affymetrix probeset data:

Annotations for 1625281_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime