Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625282_at:

>probe:Drosophila_2:1625282_at:349:275; Interrogation_Position=1541; Antisense; CTTCACCACCAGTACCAAAATATCT
>probe:Drosophila_2:1625282_at:69:487; Interrogation_Position=1552; Antisense; GTACCAAAATATCTGCCACCTACAA
>probe:Drosophila_2:1625282_at:367:179; Interrogation_Position=1557; Antisense; AAAATATCTGCCACCTACAAACCCA
>probe:Drosophila_2:1625282_at:497:265; Interrogation_Position=1591; Antisense; CAGTACTTGCCTCCGGTGCAGGTGA
>probe:Drosophila_2:1625282_at:522:667; Interrogation_Position=1594; Antisense; TACTTGCCTCCGGTGCAGGTGAAGC
>probe:Drosophila_2:1625282_at:502:273; Interrogation_Position=1596; Antisense; CTTGCCTCCGGTGCAGGTGAAGCAG
>probe:Drosophila_2:1625282_at:589:307; Interrogation_Position=1962; Antisense; CCAGAAGTACATTCCACCCGTTGTG
>probe:Drosophila_2:1625282_at:112:213; Interrogation_Position=1966; Antisense; AAGTACATTCCACCCGTTGTGCCAA
>probe:Drosophila_2:1625282_at:680:473; Interrogation_Position=2039; Antisense; GTTACGACTACCCTAAGCCAGTCAT
>probe:Drosophila_2:1625282_at:673:277; Interrogation_Position=2046; Antisense; CTACCCTAAGCCAGTCATTCCATTT
>probe:Drosophila_2:1625282_at:629:493; Interrogation_Position=2088; Antisense; GTCGGCGGGCTATTCCTACCCGAAG
>probe:Drosophila_2:1625282_at:496:329; Interrogation_Position=2092; Antisense; GCGGGCTATTCCTACCCGAAGCCGG
>probe:Drosophila_2:1625282_at:330:379; Interrogation_Position=2109; Antisense; GAAGCCGGCCATCGCATTCGACTTT
>probe:Drosophila_2:1625282_at:355:317; Interrogation_Position=2112; Antisense; GCCGGCCATCGCATTCGACTTTTGA

Paste this into a BLAST search page for me
CTTCACCACCAGTACCAAAATATCTGTACCAAAATATCTGCCACCTACAAAAAATATCTGCCACCTACAAACCCACAGTACTTGCCTCCGGTGCAGGTGATACTTGCCTCCGGTGCAGGTGAAGCCTTGCCTCCGGTGCAGGTGAAGCAGCCAGAAGTACATTCCACCCGTTGTGAAGTACATTCCACCCGTTGTGCCAAGTTACGACTACCCTAAGCCAGTCATCTACCCTAAGCCAGTCATTCCATTTGTCGGCGGGCTATTCCTACCCGAAGGCGGGCTATTCCTACCCGAAGCCGGGAAGCCGGCCATCGCATTCGACTTTGCCGGCCATCGCATTCGACTTTTGA

Full Affymetrix probeset data:

Annotations for 1625282_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime